515. Analyzing HBV-DNA in Liver Tissue for Investigation of Unexplained ALT Elevation in HBsAg Positive Patients with Undetectable Serum HBV-DNA

[Guest guest]

http://www.hbvadvocate.org/news/reports/HBV_AASLD_2008/Abstracts/AASLD%20HBV%20N\

ov%201.htm#HB515

515. Analyzing HBV-DNA in Liver Tissue for Investigation of Unexplained ALT

Elevation in HBsAg Positive Patients with Undetectable Serum HBV-DNA

C. P. Eyigun; O. Coskun; H. C. Gul; E. Gunal; A. Kubar; I. Y. Avci; H. Erdem; B.

A. Besirbellioglu; L. Gorenek

Background:

Some patients with positive HBsAg and unexplained elevated ALT have undetectable

serum HBV-DNA repetitively. In this study we tried to explain the reason for ALT

elevation in such patients and to realize the relation between liver HBV-DNA

levels and liver damage.

Materials and Methods:

Sixty-three HBsAg positive, serum HBV-DNA negative patients with unexplained

elevated ALT levels were enrolled in the study. After an informed consent, they

underwent liver biopsy. Modified Knodell’s Index was used for histopathological

examination. HBV-DNA was extracted from liver tissue and analyzed with TaqMAN

real time PCR using Forward 5’-atcctcacaataccRcagagt-3’ and Reverse

5’-caaatggcactagtaaactgagc-3’ primers and TaqMAN Prop FAM

actcgtggtggacttctctcaattttc BHQ-1 as described by Kubar et al.

Results:

The average age of the patients was 27±9.37 years. The average of ALT levels was

68.3±28.8 IU/L. Liver HBV-DNA assay in 12 (17.9 %) patients yielded negative

result. In histological examination; histopathological activity index for 3

patients was mild (moderate) and for 2; fibrotic stage was 2/6. Liver HBV-DNA

assay for 51 (82.1%) patients yielded 2 x 107 ± 4x107 copies/ml. In histological

examination; histopathological activity index for 3 patients was severe, for 7;

mild (moderate), for 4; fibrotic stage was 3/6 and for 4; 2/6. HBeAg was

positive for 9 (17.6%) of 51 cases whose HBV-DNA is positive in their liver

tissue. No correlation was observed between either liver HBV-DNA levels with ALT

levels (r=+0.1; p>0.05), with histopathological activity index (r=-0.089;

p>0.05) or with fibrosis (r=0.072; p>0.05).

Conclusion:

Despite new molecular techniques provide rapid and accurate quantification of

serum HBV-DNA, undetectable serum HBV-DNA can not satisfy diagnostic and

therapeutic criteria due to problems such as fluctuation and cut-off levels.

Liver HBV-DNA assay may help to clarify unexplained ALT levels in patients with

positive HBsAg, undetectable serum HBV-DNA and consequently prevents delays in

therapy.