Orphan Medicines approved by European Commission

[Guest guest]

Dear friends, this one is the list for Orphan medicines approved by european commission. Register of designated Orphan Medicinal Products (by number) EU Designation Product Designated Orphan Indication Sponsor Designation date TradenameEU Centralised Nr Authorisation date EU/3/00/001 Somatropin AIDS wasting Serono Europe Limited 8/08/2000 EU/3/00/002 Alpha-Galactosidase A Treatment of Fabry disease TKT Europe AB 8/08/2000 ReplagalEU/1/01/189/... 4/05/2001 EU/3/00/003 Alpha-Galactosidase A Treatment of Fabry disease Genzyme Europe B.V. 8/08/2000 FabrazymeEU/1/01/188/... 4/05/2001 EU/3/00/004 Fluorouracil Treatment of glioblastoma Ethypharm S.A. 18/10/2000 EU/3/00/005 Gemtuzumab Ozogamicin Treatment of acute myeloid leukaemia Wyeth Europa Ltd. 18/10/2000 EU/3/00/006 1,5-(Butylimino)-1,5-dideoxy, D-glucitol Treatment of Gaucher Disease Oxford GlycoSciences (UK) Ltd 18/10/2000 ZavescaEU/1/02/238/... 20/11/2002 EU/3/00/007 N-carbamyl-L-glutamic acid Treatment of N-acetylglutamate synthetase (NAGS) deficiency Orphan Europe S.a.r.l. 18/10/2000 CarbagluEU/1/02/246/... 24/01/2003 EU/3/00/008 Arsenic trioxide Treatment of acute promyelocytic leukaemia Cephalon Europe 18/10/2000 TrisenoxEU/1/02/204/... 5/03/2002 EU/3/00/009 Thalidomide Treatment of erythema nodosum leprosum (ENL) or type II lepra reactions Pharmion France 29/12/2000 EU/3/00/010 Anagrelide Hydrochloride Treatment of essential thrombocythaemia Shire Pharmaceutical Development Ltd 29/12/2000 XagridEU/1/04/295/... 16/11/2004 EU/3/00/011 Busulfan (Intravenous use) Conditioning treatment prior to hematopoietic progenitor cell transplantation Pierre Fabre Médicament 29/12/2000 BusilvexEU/1/03/254/... 9/07/2003 EU/3/00/012 Nitisinone Treatment of tyrosinaemia type I Swedish Orphan International AB 29/12/2000 OrfadinEU/1/04/303/... 21/02/2005 EU/3/00/013 Ethyl Eicosopentaenoate Treatment of Huntington’s disease Amarine Neuroscience Limited 29/12/2000 EU/3/00/014 Iloprost Treatment of primary and of the following forms of secondary pulmonary hypertension: connective tissue disease pulmonary hypertension, drug-induced pulmonary hypertension, portopulmonary hypertension, pulmonary hypertension associated with congenital heart disease, chronic thromboembolic pulmonary hypertension Schering AG 29/12/2000 VentavisEU/1/03/255/... 16/09/2003 EU/3/00/015 Xaliproden hydrochloride Treatment of amyotrophic lateral sclerosis Sanofi-Aventis 17/01/2001 EU/3/00/016 Lusupultide Treatment of Acute Respiratory Distress Syndrome Nycomed GmbH 17/01/2001 EU/3/00/018 Recombinant human acid alpha-glucosidase Treatment of Glycogen Storage Disease type II (Pompe´s disease) Genzyme Europe B.V. 14/02/2001 MyozymeEU/1/06/333/... 29/03/2006 EU/3/01/019 Bosentan Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Actelion Registration Limited 14/02/2001 TracleerEU/1/02/220/... 15/05/2002 EU/3/01/020 Ibuprofen Treatment of patent ductus arteriosus Orphan Europe S.a.r.l. 14/02/2001 PedeaEU/1/04/284/... 29/07/2004 EU/3/01/021 Imatinib mesylate Treatment of chronic myeloid leukaemia Novartis Europharm Limited 14/02/2001 GlivecEU/1/01/198/... 27/08/2001 EU/3/01/022 Laronidase Treatment of Mucopolysaccharidosis, type I Genzyme Europe B.V. 14/02/2001 AldurazymeEU/1/03/253/... 10/06/2003 EU/3/01/023 Pegvisomant Treatment of acromegaly Pfizer Ltd 14/02/2001 SomavertEU/1/02/240/... 13/11/2002 EU/3/01/024 Ribavirin Treatment of haemorrhagic fever with renal syndrome ICN Pharmaceuticals Limited 14/02/2001 EU/3/01/025 N-acetylgalactosamine-4-sulfatase Treatment of Mucopolysaccharidosis, type VI (Maroteaux-Lamy Syndrome) BioMarin Europe Ltd 14/02/2001 NaglazymeEU/1/05/324/... 24/01/2006 EU/3/01/026 L-Lysine-N-acetyl-L-cysteinate Treatment of cystic fibrosis SMB Technology SA 14/02/2001 EU/3/01/027 Ibuprofen Prevention of patent ductus arteriosus in premature neonates of less than 34 weeks of gestational age Orphan Europe S.a.r.l. 5/03/2001 EU/3/01/028 Inolimomab Treatment of Graft versus Host Disease EUSA Pharma SAS 5/03/2001 EU/3/01/030 8-cyclopentlyl-1,3-dipropylxanthine Treatment of cystic fibrosis SciClone Pharmaceuticals Italy

S.r.l 29/03/2001 EU/3/01/031 Arsenic Trioxide Treatment of myelodysplastic syndromes Cephalon Europe 29/03/2001 EU/3/01/032 Arsenic Trioxide Treatment of multiple myeloma Cephalon Europe 29/03/2001 EU/3/01/033 Ranpirnase Treatment of malignant mesothelioma Dr Morgenstern 29/03/2001 EU/3/01/034 Gusperimus trihydrochloride Treatment of Wegener´s granulomatosis Euro Nippon Kayaku GmbH 29/03/2001 EU/3/01/035 Levodopa and Carbidopa (Gastroenteral use) Treatment of advanced idiopathic Parkinson´s disease with severe motor fluctuations and not responding to oral treatment Solvay Pharmaceuticals GmbH 10/05/2001 EU/3/01/036 Recombinant human C1-inhibitor Treatment of angioedema caused by C1 inhibitor deficiency Pharming Group N.V. 11/05/2001 EU/3/01/038 Retroviral gamma-c cDNA containing vector Treatment of Severe Combined Immunodeficiency (SCID)-Xl Disease GENOPOIETIC S.A.S. 30/05/2001 EU/3/01/039 Ecteinascidin 743 Treatment of soft tissue sarcoma PharmaMar S.A. 30/05/2001 YondelisEU/1/07/417/... 17/09/2007 EU/3/01/041 Recombinant human alpha-1-antitrypsin (respiratory use) Treatment of emphysema secondary to congenital alpha 1-antitrypsin deficiency Bayer HealthCare AG 30/05/2001 EU/3/01/042 Human engineered monoclonal antibody specific for Transforming Growth Factor ß2 Prevention of scarring in glaucoma filtration surgical procedures Cambridge Antibody Technology 30/05/2001 EU/3/01/044 Human Alpha1-Proteinase Inhibitor (respiratory use) Treatment of emphysema secondary to congenital alpha 1-antitrypsin deficiency CSL Behring GmbH 9/07/2001 EU/3/01/045 Betaine anhydrous Treatment of homocystinuria Orphan Europe S.a.r.l. 9/07/2001 CystadaneEU/1/06/379/... 15/02/2007 EU/3/01/046 Thalidomide Treatment of Graft versus Host Disease Pharmion France 9/07/2001 EU/3/01/047 Thalidomide Treatment of multiple myeloma Pharmion France 9/07/2001 EU/3/01/048 Ziconotide (intraspinal use) Treatment of chronic pain requiring intraspinal analgesia Eisai Limited 9/07/2001 PrialtEU/1/04/302/... 21/02/2005 EU/3/01/049 Ramoplanin Prevention of invasive infections due to Vancomycin Resistant Enterococci (VRE) in colonised patients deemed at risk of infection Vicuron Pharmaceuticals Italy srl, 9/07/2001 EU/3/01/050 Zinc acetate dihydrate Treatment of ´s disease Orphan Europe S.a.r.l.

31/07/2001 WilzinEU/1/04/286/... 13/10/2004 EU/3/01/051 1,3-Propanedisulfonic acid, disodium salt Treatment of Systemic Secondary Amyloidosis Neurochem Luxco II S.A.R.L. 31/07/2001 EU/3/01/054 Sinapultide, dipalmitoylfosfatidylcholine, palmitoyloleoyl fosfatidylglycerol and palmitic acid Treatment of Meconium Aspiration Syndrome Discovery Laboratories Inc. 19/09/2001 EU/3/01/055 Cladribine (subcutaneous use) Treatment of indolent non-Hodgkin´s lymphoma Lipomed GmbH 18/09/2001 kEU/1/04/275/... 14/04/2004 EU/3/01/056 Recombinant human acid sphingomyelinase Treatment of Niemann-Pick Disease, type B Genzyme Europe B.V. 19/09/2001 EU/3/01/058 Repertaxin L-lysine salt Prevention of delayed graft function in organ transplant Dompé s.p.a. 19/09/2001 EU/3/01/059 Dexrazoxane Treatment of anthracycline extravasations TopoTarget A/S 19/09/2001 SaveneEU/1/06/350/... 28/07/2006 EU/3/01/061 Imatinib mesilate Treatment of malignant gastrointestinal stromal tumours Novartis Europharm Limited 20/11/2001

EU/3/01/062 Idebenone Treatment of Friedreich’s ataxia Laboratoires Takeda 20/11/2001 EU/3/01/063 Deoxyribose phosphorothioate (5´-tct-ccc-agc-gtg-cgc-cat-3´) Treatment of chronic lymphocytic leukaemia Voisin Consulting

S.A.R.L. 20/11/2001 EU/3/01/064 Abetimus sodium Treatment of lupus nephritis La Jolla Limited 20/11/2001 EU/3/01/065 Deoxyribose phosphorothioate

(5´-tct-ccc-agc-gtg-cgc-cat-3´) Treatment of multiple myeloma Voisin Consulting S.A.R.L. 20/11/2001 EU/3/01/066 Thalidomide Treatment of erythema nodosum leprosum (ENL) or type II lepra reactions Pharmion Limited 20/11/2001 EU/3/01/067 Thalidomide Treatment of multiple myeloma Pharmion Limited 20/11/2001 EU/3/01/068 Thalidomide Treatment of multiple myeloma Kendle International Ltd 19/12/2001 EU/3/01/069 Phenylephrine Hydrochloride Treatment of ileal pouch anal anastomosis related faecal incontinence S.L.A. Pharma (UK) Limited 20/11/2001 EU/3/01/070 Celecoxib Treatment of Familial

Adenomatous Polyposis Pfizer Limited 20/11/2001 OnsenalEU/1/03/259/... 17/10/2003 EU/3/01/071 Stiripentol Treatment of severe myoclonic epilepsy in infancy Biocodex 5/12/2001 DiacomitEU/1/06/367/... 4/01/2007 EU/3/01/073 Recombinant human monoclonal antibody to hsp90 Treatment of invasive fungal infections Novartis Europharm Limited 5/12/2001 EU/3/01/074 Halofuginone Hydrobromide Treatment of Systemic Sclerosis PPD Global Ltd 11/12/2001 EU/3/01/075 Denileukin diftitox Treatment of cutaneous T-cell lymphoma Ligand Pharmaceuticals UK Ltd 11/12/2001 EU/3/01/077 [gly2] Recombinant human glucagon-like peptide Treatment of Short Bowel Syndrome PAREXEL International Limited 11/12/2001 EU/3/01/078 Iduronate-2-sulfatase Treatment of

Mucopolysaccharidosis, type II (Hunter Syndrome) TKT Europe AB 11/12/2001 ElapraseEU/1/06/365/... 8/01/2007 EU/3/01/079 Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid Treatment of acute lung injury Discovery Laboratories Inc. 4/02/2002 EU/3/01/081 Fumagillin Treatment of diarrhoea associated with intestinal microsporidial infection Sanofi-Aventis 4/02/2002 EU/3/01/082 2-chloro-9-[2-deoxy-2-fluoro-ß-D-arabinofuranosyl]adenine Treatment of acute lymphoblastic leukaemia Bioenvision Limited 5/02/2002 EvoltraEU/1/06/334/... 29/05/2006 EU/3/01/083 Adenovirus-mediated Herpes Simplex Virus-thymidine kinase gene Treatment of high-grade glioma with subsequent use of

ganciclovir sodium Ark Therapeutics Ltd 6/02/2002 EU/3/01/084 Azacitidine Treatment of myelodysplastic syndromes Pharmion Limited 6/02/2002 EU/3/02/085 Carmustine (solution for intratumoral injection) Treatment of glioma Icon Clinical Research UK Ltd 5/03/2002 EU/3/02/086 Porfimer sodium (for use with photodynamic therapy) Treatment of high-grade dysplasia in Barrett´s Esophagus Axcan Pharma International BV 6/03/2002 PhotoBarrEU/1/04/272/... 25/03/2004 EU/3/02/088 Colistimethate sodium Treatment of Pseudomonas aeruginosa lung infection (including colonisation) in cystic fibrosis Forest Laboratories UK Ltd 19/02/2002 EU/3/02/091 TGF-ß2 specific phosphorothioate antisense oligodeoxynucleotide Treatment of high-grade glioma Antisense Pharma GmbH 22/03/2002 EU/3/02/092 4-(3,5-bis-(hydroxy-phenyl)-1,2,4) triazol-1-yl)-benzoic acid Treatment of chronic iron overload requiring chelation therapy Novartis Europharm

Limited 13/03/2002 ExjadeEU/1/06/356/... 28/08/2006 EU/3/02/093 Beclomethasone 17, 21-dipropionate (oral use) Treatment of intestinal graft-versus-host disease Voisin Consulting S.A.R.L. 13/03/2002 EU/3/02/094 Chimeric IgG monoclonal antibody cG250 Treatment of renal cell carcinoma Wilex AG 19/03/2002 EU/3/02/095 Iodine (131I) chimeric IgG monoclonal antibody cG250 Treatment of renal cell carcinoma Wilex AG 19/03/2002 EU/3/02/096 Nitisinone Treatment of alkaptonuria Swedish Orphan International AB 13/03/2002 EU/3/02/098 Epothilone B Treatment of ovarian cancer Novartis Europharm Limited 22/03/2002 EU/3/02/100 Recombinant human alpha-1-antitrypsin (respiratory use) Treatment of emphysema secondary to congenital alpha-1-antitrypsin deficiency MDS Pharma Services France SAS 30/04/2002 EU/3/02/101 Pseudomonas exotoxin (domains II/III)-Interleukin 13 chimeric protein Treatment of glioma PPD Global Ltd 30/04/2002 EU/3/02/102 Mitotane Treatment of adrenal cortical carcinoma Laboratoire HRA Pharma 12/06/2002 LysodrenEU/1/04/273/... 28/04/2004 EU/3/02/103 Recombinant Human Porphobilinogen Deaminase Treatment of acute intermittent porphyria Zymenex A/S 12/06/2002

EU/3/02/104 Miltefosine Treatment of visceral leishmaniasis Zentaris GmbH 12/06/2002 EU/3/02/106 Antisense NF-kappaB p65 Oligonucleotide Treatment of active ulcerative colitis InDex Pharmaceuticals AB 30/07/2002 EU/3/02/107 Purified bromelain Treatment of partial deep dermal and full thickness burns Professor Judkins 30/07/2002 EU/3/02/108 Myristoylated-peptidyl-recombinant SCR1-3 of

human complement receptor type I Prevention of post transplantation graft dysfunction Adprotech Limited 30/07/2002 EU/3/02/109 Oregovomab Treatment of ovarian cancer ViRexx International Corp. Limited 30/07/2002 EU/3/02/110 Thymalfasin Treatment of hepatocellular carcinoma SciClone Pharmaceuticals Italy S.r.l 30/07/2002 EU/3/02/111 Benzoic acid, sodium salt Treatment of non-ketotic hyperglycinaemia Ethicare GmbH 11/09/2002 EU/3/02/112 Doxorubicin carbon/iron magnetically targeted microparticles Treatment of hepatocellular carcinoma Interface International Consultancy Limited 11/09/2002 EU/3/02/114 Myristoylated-peptidyl-recombinant Human CD59 Treatment of paroxysmal nocturnal haemoglubinuria Adprotech Limited 11/09/2002 EU/3/02/115 (-)-17-(cyclopropylmethyl)-3,14 ß-dihydroxy-4,5 a-epoxy-6ß-[N-methyl-trans-3-(3-furyl) acrylamido] morphinan hydrochloride (intravenous use) Treatment of uremic pruritus Toray International U.K. Limited 11/09/2002 EU/3/02/116 Autologous renal cell tumor vaccine Treatment of renal cell carcinoma Liponova GmbH 21/10/2002 EU/3/02/118 Recombinant glycoprotein gp350 of Epstein-Barr virus Prevention of post transplantation lympho-proliferative disorders Henogen S.A. 22/10/2002 EU/3/02/119 Iodine (¹³¹I) anti-nucleohistone H1 chimeric biotinylated monoclonal antibody Treatment of glioma Interface International Consultancy Limited 13/11/2002

EU/3/02/120 Duramycin Treatment of cystic fibrosis AOP Orphan Pharmaceuticals AG 13/11/2002 EU/3/02/121 5-aminolevulinic acid hydrochloride Intra-operative photodynamic diagnosis of residual glioma Medac Gesellschaft für klinische Spezialpräparate mbH 13/11/2002 GliolanEU/1/07/413/... 7/09/2007 EU/3/02/122 Etilefrin Treatment of low flow priapism Laboratoires SERB 13/11/2002 EU/3/02/124 3,4-diaminopyridine phosphate Treatment of Lambert-Eaton myasthenic syndrome EUSA Pharma SAS 18/12/2002 EU/3/02/125 Monoclonal antibody to human interleukin-6 Treatment of post-transplant lymphoproliferative disorders EUSA Pharma SAS 18/12/2002 EU/3/02/126 Recombinant inhibitor of human plasma kallikrein treatment of angioedema Dyax s.a. 18/12/2002 EU/3/02/127 Cholic acid Treatment of inborn errors in primary bile acid synthesis Agence générale des équipements et produits de santé - Etablissement pharmaceutique des hôpitaux de Paris (AGEPS-EPHP) 18/12/2002 EU/3/02/128 Carboxypeptidase G2 Adjunctive treatment in patients at risk of methotrexate toxicity Enact Pharma PLC 3/02/2003 EU/3/02/129 G17(9) gastrin-diphtheria toxoid conjugate Treatment of pancreatic cancer Kendle International Ltd 24/01/2003 EU/3/02/130 G17(9) gastrin-diphtheria toxoid conjugate Treatment of gastric cancer Kendle International Ltd 28/01/2003 EU/3/02/131 Sodium oxybate Treatment of narcolepsy UCB Pharma Ltd. 3/02/2003 XyremEU/1/05/312/... 13/10/2005 EU/3/03/132 Caffeine citrate Treatment of primary apnoea of premature newborns Chiesi Farmaceutici S.P.A. 17/02/2003 EU/3/03/133 Icatibant acetate treatment of angioedema Jerini AG 17/02/2003

EU/3/03/134 Iodine (123I) Serum Amyloid P Diagnosis of the extent of histologically proven amyloidosis MEDIAM 14/02/2003 EU/3/03/135 Decitabine Treatment of myelodysplastic

syndromes Janssen-Cilag International NV 14/02/2003 EU/3/03/136 Iodine (¹³¹I) tositumomab Treatment of follicular lymphoma GlaxoKline Research & Development Limited 14/02/2003 EU/3/03/137 Tositumomab Treatment of follicular lymphoma GlaxoKline Research & Development Limited 14/02/2003 EU/3/03/138 a -1-acid glycoprotein Treatment of tricyclic antidepressants poisoning Bio Products Laboratory 20/03/2003 EU/3/03/139 Bosentan Treatment of systemic sclerosis Actelion Registration Limited 17/03/2003 EU/3/03/140 Tobramycin (inhalation powder) Treatment of

Pseudomonas aeruginosa lung infection in cystic fibrosis Chiron Corporation Ltd 17/03/2003 EU/3/03/141 2-chloro-9-[2-deoxy-2-fluoro-ß-D-arabinofuranosyl]adenine Treatment of acute myeloid leukaemia Bioenvision Limited 8/05/2003 EU/3/03/142 Iodine (131I) anti-CEA sheep-human chimeric monoclonal antibody Treatment of pancreatic cancer Xenova Biomedix Limited 7/05/2003 EU/3/03/143 5-10-Methylene-tetrahydrofolate Treatment of pancreatic cancer in combination with 5-fluorouracil Interface International Consultancy Limited 11/06/2003 EU/3/03/144 Liarozole Treatment of congenital ichthyoses Barrier Therapeutics NV 10/06/2003 EU/3/03/145 Rubitecan Treatment of pancreatic cancer Eurogen Pharmaceuticals Limited 10/06/2003 EU/3/03/147 Amiloride hydrochloride dihydrate Treatment of cystic fibrosis Pulmo Tec GmbH 30/06/2003 EU/3/03/148 Chimeric-anti-interleukin-6 monoclonal antibody Treatment of renal cell carcinoma Centocor B.V. 30/06/2003 EU/3/03/149 Cytochrome P450 isoform 2B1 gene transfected human embryonic kidney 293 cells encapsulated in polymeric cellulose sulphate Treatment of pancreatic cancer in combination with ifosfamide Austrianova Biotechnology GmbH 30/06/2003 EU/3/03/150 Adenovirus-Interferon gamma – coding DNA sequence Treatment of cutaneous T-cell lymphoma Transgene S.A. 9/07/2003 EU/3/03/151 Aplidine Treatment of acute lymphoblastic leukaemia Pharma Mar SA Sociedad Unipersonal 9/07/2003 EU/3/03/152 Engineered protein inhibitor of human neutrophil elastase Treatment of cystic fibrosis Debioclinic SA 9/07/2003 EU/3/03/153 Herpes simplex virus lacking infected cell protein 34.5 Treatment of glioma Crusade Laboratories Limited 9/07/2003 EU/3/03/154 Hydroxyurea Treatment of sickle

cell syndrome Addmedica 9/07/2003 SiklosEU/1/07/397/... 29/06/2007 EU/3/03/155 Murine anti-idiotypic antibody against OC125 antibody against CA125 antigen Treatment of ovarian cancer Menarini Ricerche S.p.A. 9/07/2003 EU/3/03/156 Prasterone Treatment of adrenal insufficiency Medicom Healthcare BV 28/07/2003 EU/3/03/157 Recombinant dog gastric lipase Treatment of cystic fibrosis Meristem Therapeutics S.A. 9/07/2003 EU/3/03/158 Recombinant Human Arylsulfatase A Treatment of metachromatic leukodystrophy Zymenex A/S 9/07/2003 EU/3/03/160

Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) Treatment of retinopathy of prematurity Gene Signal SAS 2/10/2003 EU/3/03/161 Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) Treatment of neovascular glaucoma Gene Signal SAS 2/10/2003 EU/3/03/162 Yttrium (90Y) antiferritin polyclonal antibodies Treatment of Hodgkin lymphoma Monoclonal Antibodies Therapeutics (MAT) 2/10/2003 EU/3/03/163 5,6,7,8-Tetrahydrobiopterin Treatment of hyperphenylalaninemia Orphanetics Pharma Entwicklungs GmbH 2/10/2003 EU/3/03/164 a-1-acid glycoprotein Treatment of cocaine poisoning Bio Products Laboratory 2/10/2003 EU/3/03/166 Eculizumab Treatment of paroxysmal nocturnal haemoglobinuria ion Europe SAS 17/10/2003 SolirisEU/1/07/393/... 20/06/2007 EU/3/03/167 H-Tyrosine-Glycine-Phenylalanine-Glycine-Glycine-OH Treatment of chronic idiopathic myelofibrosis Abiogen Pharma S.p.A. 20/10/2003 EU/3/03/168 Herpes simplex 1 virus-thymidine kinase and truncated low affinity nerve growth factor receptor transfected donor lymphocytes adjunctive treatment in hematopoietic cell transplantation MolMed SpA 20/10/2003 EU/3/03/169 Human immunoglobulin Treatment of dermatomyositis Orfagen 20/10/2003 EU/3/03/170 Human immunoglobulin Treatment of polymyositis Orfagen 24/10/2003 EU/3/03/171 Trabectedin Treatment of ovarian cancer Pharmamar S.A. Sociedad Unipersonal 17/10/2003 EU/3/03/172 Trientine dihydrochloride Treatment of ´s disease Univar Limited 24/10/2003 EU/3/03/173 Vasoactive intestinal peptide Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension mondoBIOTECH Laboratories Anstalt 22/12/2003 EU/3/03/174 Gimatecan Treatment of glioma Novartis Europharm Limited 1/12/2003 EU/3/03/175 Recombinant antibody derivative against human CD19 and CD3 Treatment of mantle cell lymphoma Micromet AG 1/12/2003

EU/3/03/176 Recombinant antibody derivative against human CD19 and CD3 Treatment of chronic lymphocytic leukaemia Micromet AG 1/12/2003 EU/3/03/177 3-(4´aminoisoindoline-l´-one)-1-piperidine-2,6-dione Treatment of multiple myeloma Celgene Europe Limited 12/12/2003 RevlimidEU/1/07/391/... 14/06/2007 EU/3/03/178 Sildenafil citrate Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Pfizer Ltd 12/12/2003 RevatioEU/1/05/318/... 28/10/2005 EU/3/03/179 Recombinant human factor XIII (composed of two A subunits) Treatment of hereditary factor XIII deficiency Novo Nordisk A/S 12/12/2003 EU/3/03/180 4,5-dihydro-2-(2,4-dihydroxyphenyl)-4-methylthiazole-4(S)-carboxylic acid Treatment of chronic iron overload requiring chelation therapy Genzyme Europe B.V. 12/12/2003 EU/3/03/181 N-acetylsarcosyl-glycyl-L-valyl-D-allo-isoleucyl-L-threonyl-L-norvalyl-L-isoleucyl-L-arginyl-L-prolyl-N-ethylamide Treatment of soft tissue

sarcoma Abbott International European Office 12/12/2003 EU/3/03/182 5-methyl-pyridine-2-sulfonic acid {6-(2-hydroxy-ethoxy)-5-(2-methoxy-phenoxy)-2-[2-(1H-tetrazol-5-yl)-pyridin-4-yl]-pyrimidin-4-yl}-amide sodium salt Treatment of aneurysmal subarachnoid haemorrhage Axovan Europe Ltd 12/12/2003

EU/3/03/183 Temocillin sodium Treatment of Burkholderia cepacia lung infection in cystic fibrosis Belpharma N.V 14/01/2004 EU/3/03/184 Cilengitide Treatment of glioma Merck KGaA 14/01/2004

EU/3/03/185 Tacrolimus hydrate Treatment of vernal keratoconjunctivitis Sucampo Pharma Europa Ltd 14/01/2004 EU/3/04/186 Treosulfan Conditioning

treatment prior to haematopoietic progenitor cell transplantation Medac Gesellschaft für klinische Spezialpräparate mbH 23/02/2004 EU/3/04/187 Human monoclonal hepatitis B immunoglobulins Prevention of hepatitis B re-infection following liver transplantation ICON Clinical Research (UK) Ltd 23/02/2004 EU/3/04/188 N-3[[4(aminoiminomethyl)benzoyl] amino]propyl]-1-[[2,4-dichloro-3-[[2,4-dimethyl-8- quinolinyl)oxy]methyl] phenyl]sulphonyl]-(2S)-2-pyrrolidinecarboxamide, di(methanesulfonate) Treatment of moderate and severe traumatic brain injury Xytis Pharmaceuticals Limited 23/02/2004 EU/3/04/189 Idebenone Treatment of Friedreich’s ataxia Santhera Pharmaceuticals (Deutschland) GmbH 8/03/2004 EU/3/04/190 Ethanol (96 per cent ) (gel for injection) Treatment of congenital lymphatic malformations Orfagen 8/03/2004 EU/3/04/191 Ethanol (96 per cent ) (gel for injection) Treatment of congenital venous malformations Orfagen 8/03/2004 EU/3/04/192 3-(4'aminoisoindoline-1'-one)-1-piperidine-2,6-dione Treatment of myelodysplastic syndromes Celgene Europe Limited 8/03/2004 EU/3/04/193 Anti-epithelial cell adhesion molecule / anti-CD3 monoclonal antibody Treatment of ovarian cancer Fresenius Biotech GmbH 8/03/2004 EU/3/04/194 Adeno-associated viral vector expressing lipoprotein lipase Treatment of lipoprotein lipase deficiency Dr J. Gringeri 8/03/2004 EU/3/04/195 2-Methoxy-5-[(1Z)-2-(3,4,5-trimethoxyphenyl)ethenyl]-phenol Treatment of anaplastic thyroid cancer Dr Chaplin 14/04/2004 EU/3/04/197 Treprostinil sodium Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension United Therapeutics Europe Ltd 14/04/2004 EU/3/04/198 Human monoclonal antibody against CD4 Treatment of

cutaneous T-cell lymphoma Serono Europe Limited 14/04/2004 EU/3/04/199 Tetrahydrobiopterin Treatment of hyperphenylalaninemia Merck KGaA 8/06/2004 EU/3/04/200 (2-aminoethyl) carbamic acid (2R,5S,8S,11S,14R,17S,19aS)-11-(4-aminobutyl)-5-benzyl-8-(4-benzyloxy benzyl)-14-(1H-indol-3-ylmethyl)-4,7,10,13,16,19-hexaoxo-17-phenyloctadecahydro-3a,6,9,12,15,18-hexaazacyclopentacyclooctadecen-2-yl ester, di[(S)-2-aminosu Treatment of functional gastro-entero-pancreatic endocrine tumours Novartis Europharm Limited 8/06/2004 EU/3/04/201 Vascular

endothelial growth factor-D gene in an adenoviral vector for use with a collagen collar Prevention of stenosis in synthetic grafts used in haemodialysis Ark Therapeutics Ltd 8/06/2004 EU/3/04/202 HLA-A2 restricted CD8 T-cell line expressing MART-1 T-cell receptor Treatment of MART-1 positive malignant melanoma in HLA-A2 positive patients Cellcure A/S 21/06/2004 EU/3/04/203 5’-CTG CCA CGT TCT CCT GC-(2’ methoxy)A-(2’ methoxy)C-(2’ methoxy)C-3’ Treatment of myasthenia gravis PPD Global Ltd 21/06/2004 EU/3/04/204 Aztreonam lysinate (inhalation

use) Treatment of gram negative bacteria lung infections in cystic fibrosis Gilead Sciences International Limited 21/06/2004 EU/3/04/205 Suberoylanilide hydroxamic acid Treatment of cutaneous T-cell lymphoma Merck Sharp & Dohme Ltd 21/06/2004 EU/3/04/206 Muramyl tripeptide phosphatidyl ethanolamine Treatment of osteosarcoma Immuno-Designed Molecules, SA 21/06/2004 EU/3/04/207 Sorafenib tosylate Treatment of renal cell carcinoma Bayer HealthCare AG 29/07/2004 NexavarEU/1/06/342/... 19/07/2006 EU/3/04/208 Acetylsalicylic acid Treatment of polycythemia vera Bayer HealthCare AG 29/07/2004 EU/3/04/209 Ciclosporin (inhalation use) Prevention of graft rejection after lung transplantation PARI Aerosol Research Institute 29/07/2004 EU/3/04/210 Ciclosporin (inhalation use) Treatment of graft rejection after lung transplantation PARI Aerosol Research Institute 29/07/2004 EU/3/04/211 Defibrotide Prevention of hepatic veno-occlusive disease Gentium S.p.A. 29/07/2004 EU/3/04/212 Defibrotide Treatment of hepatic veno-occlusive disease Gentium S.p.A. 29/07/2004 EU/3/04/213 Mepolizumab Treatment of hypereosinophilic syndrome Kline Beecham plc 29/07/2004 EU/3/04/214 Midostaurin Treatment of acute myeloid leukaemia Novartis Europharm Limited 29/07/2004 EU/3/04/215 Porfimer sodium (for use with photodynamic therapy) Treatment of cholangiocarcinoma Axcan Pharma International BV 29/07/2004

EU/3/04/216 Sinapultide, dipalmitoylphosphatidylcholine, palmitoyloleoylphosphatidylglycerol and palmitic acid Prevention of respiratory distress syndrome in premature neonates of less than 32 weeks of gestational age GMG BioBusiness Ltd. 29/07/2004 EU/3/04/217

Sinapultide, dipalmitoylphosphatidylcholine, palmitoyloleoylphosphatidylglycerol and palmitic acid Treatment of respiratory distress syndrome in premature neonates of less than 37 weeks of gestational age GMG BioBusiness Ltd. 29/07/2004 EU/3/04/218 (R, S)-3-(bromomethyl)-3-butanol-1-yl-diphosphate Treatment of renal cell carcinoma Innate Pharma SAS 29/07/2004 EU/3/04/219 HLA-B27 derived peptide (amino acid 125-138) Treatment of autoimmune uveitis Dr Gerhild Wildner 2/09/2004 EU/3/04/220 Anti epidermal growth factor

receptor antibody h-R3 Treatment of glioma Oncoscience AG 2/09/2004 EU/3/04/221 5,10-methylene-tetrahydrofolic acid Treatment of pancreatic cancer in combination with 5-fluorouracil Interface International Consultancy Limited 2/09/2004 EU/3/04/222 Pancreatic enzymes (cross linked enzyme crystal lipase, protease, amylase) Treatment of malabsorption due to exocrine pancreatic enzyme insufficiency Dr Falk, Pharma GmbH 2/09/2004 EU/3/04/223 Heparin sodium Treatment of idiopathic pulmonary fibrosis Prof. Dr Seeger 2/09/2004 EU/3/04/224 Homoharringtonine Treatment of chronic myeloid leukaemia Stragen France SAS 2/09/2004 EU/3/04/225 Sodium dichloroacetate Treatment of systemic monochloroacetate poisoning Dr W. Fox 2/09/2004 EU/3/04/226 Recombinant human interleukin-21 Treatment of renal cell carcinoma Novo Nordisk A/S 2/09/2004 EU/3/04/227 l, 1´-[1,4-phenylenebis (methylene)]-bis-1,4,8,11- tetraazacyclotetradecane Treatment to mobilize progenitor cells prior to stem cell transplantation Genzyme Europe B.V. 20/10/2004 EU/3/04/228 Homoharringtonine Treatment of acute myeloid leukaemia Stragen France SAS 20/10/2004 EU/3/04/229 Doxorubicin polyisohexylcyanoacrylate nanoparticles Treatment of the hepatocellular carcinoma BioAlliance Pharma 21/10/2004 EU/3/04/230 Dexamethasone sodium phosphate encapsulated in human erythrocytes Treatment of cystic fibrosis Sorin Group Italia S.r.l. 20/10/2004 EU/3/04/231 Deferoxamine mesilate Treatment of traumatic spinal cord injury Neuraxo Biopharmaceuticals GmbH 20/10/2004 EU/3/04/232 Biotinylated anti-tenascin monoclonal antibody for use with 90-Yttrium Treatment of glioma Sigma Tau Industrie Farmaceutiche Riunite S.p.A 20/10/2004 EU/3/04/233 Adeno-associated viral vector containing the human gamma-sarcoglycan gene Treatment of gamma-sarcoglycanopathy Généthon 21/10/2004 EU/3/04/234 Sitaxentan sodium Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Encysive (UK) Limited 21/10/2004 ThelinEU/1/06/353/... 10/08/2006 EU/3/04/239 Deuterium oxide Treatment of pancreatic cancer BDD Berolina Drug Development GmbH 20/10/2004 EU/3/04/240 Rufinamide

Treatment of Lennox-Gastaut syndrome Eisai Limited 20/10/2004 InovelonEU/1/06/378/... 16/01/2007 EU/3/04/241 Pirfenidone Treatment of idiopathic pulmonary fibrosis Uppsala Medical Information System AB 16/11/2004 EU/3/04/242 N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole Treatment of mastocytosis OxThera AB 16/11/2004 EU/3/04/243 Alpha-1 antitrypsin (inhalation use) Treatment of cystic fibrosis The Weinberg Group LLC 16/11/2004 EU/3/04/244 Alpha-1 antitrypsin (inhalation use) Treatment of emphysema secondary to congenital alpha-1 antitrypsin deficiency The Weinberg Group LLC 16/11/2004 EU/3/04/245 Aplidine Treatment of multiple myeloma Pharma Mar SA Sociedad Unipersonal 16/11/2004 EU/3/04/246 Eptacog alfa (activated) Treatment of Familial Adenomatous Polyposis TopoTarget Germany AG 30/11/2004 EU/3/04/247 EU/3/04/247 Treatment of multiple myeloma Wainwright Associates Ltd 21/12/2004 EU/3/04/248 Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors Treatment of multiple myeloma CellGenix Technologie Transfer GmbH 21/12/2004 EU/3/04/249 Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors Treatment of follicular lymphoma CellGenix Technologie Transfer GmbH 23/12/2004 EU/3/04/250 Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors Treatment of mantle cell lymphoma CellGenix Technologie Transfer GmbH 21/12/2004 EU/3/04/251 N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole Treatment of

malignant gastro intestinal stromal tumours Dr Geoffrey Allan 21/12/2004 EU/3/04/252 Val-Leu-Gln-Glu-Leu-Asn-Val-Thr-Val (Pr1 nanopeptide, sequence 169-177, of proteinase 3) Treatment of chronic myeloid leukemia Accelsiors CRO & Consultancy Services GmbH 21/12/2004 EU/3/04/253 Val-Leu-Gln-Glu-Leu-Asn-Val-Thr-Val (Pr1 nanopeptide, sequence 169-177, of proteinase 3) Treatment of acute myeloid leukaemia Accelsiors CRO & Consultancy Services GmbH 21/12/2004 EU/3/04/254 Val-Leu-Gln-Glu-Leu-Asn-Val-Thr-Val (Pr1 nanopeptide, sequence 169-177, of proteinase 3) Treatment

of myelodysplastic syndromes Accelsiors CRO & Consultancy Services GmbH 21/12/2004 EU/3/04/255 Sabarubicin Treatment of small cell lung cancer Menarini Ricerche S.p.A. 21/12/2004 EU/3/04/256 17-allylamino-17-demethoxygeldanamycin Treatment of chronic myeloid leukemia Wainwright Associates Ltd 26/01/2005 EU/3/04/257 Recombinant human bile salt-stimulated lipase Treatment of cystic fibrosis Arexis AB 26/01/2005 EU/3/04/258 L-Asparaginase Treatment of acute lymphoblastic leukaemia Medac Gesellschaft für klinische Spezialpräparate mbH 26/01/2005 EU/3/04/259 Acetylcysteine Treatment

of idiopathic pulmonary fibrosis Zambon Group Spa 26/01/2005 EU/3/04/260 Recombinant human alpha-Mannosidase Treatment of alpha-Mannosidosis Zymenex A/S 26/01/2005 EU/3/05/261 Fluocinolone acetonide (prolonged-release intravitreal implant) Treatment of non-infectious uveitis affecting the posterior segment of the eye Bausch & Lomb Ireland 7/03/2005 EU/3/05/262 Titanium dioxide and bisoctrizole Treatment of UV-A and visible light-induced photosensitivity disorders (chronic actinic dermatitis, cutaneous

porphyrias, actinic prurigo and solar urticaria) Orfagen 3/03/2005 EU/3/05/263 dimethyl sulfoxide Treatment of severe closed traumatic brain injury AOP Orphan Pharmaceuticals AG 3/03/2005 EU/3/05/264 Cholest-4-en-3-one, oxime Treatment of 5q spinal muscular atrophies Trophos SA 10/03/2005 EU/3/05/265 ciclosporin (inhalation use) Treatment of graft rejection after lung transplantation Chiron Corporation Limited 10/03/2005 EU/3/05/266 Ciclosporin (inhalation use) Prevention of graft rejection after lung transplantation Chiron Corporation Limited (trading as Chiron Biopharmaceuticals) 10/03/2005 EU/3/05/267 (Z)-N-[2-(Diethylamino)ethyl]-5-[(5-fluoro-2-oxo-1,2-dihydro-3Hindol-3-ylidene)methyl]-2,4-dimethyl-1H-pyrrole-3-carboxamide (S)-2-hydroxysuccinate Treatment of malignant gastrointestinal stromal tumours Pfizer Ltd 10/03/2005 SUTENTEU/1/06/347/... 19/07/2006 EU/3/05/268 (Z)-N-[2-(Diethylamino)ethyl]-5-[(5-fluoro-2-oxo-1,2-dihydro-3Hindol-3-ylidene)methyl]-2,4-dimethyl-1H-pyrrole-3-carboxamide (S)-2-hydroxysuccinate Treatment of renal cell carcinoma Pfizer Ltd 10/03/2005 EU/3/05/269 Tipifarnib Treatment of acute myeloid leukaemia Janssen-Cilag International NV 10/03/2005 EU/3/05/270 Autologous Tumor-Derived gp96 Heat Shock Protein-Peptide Complex Treatment of renal cell carcinoma Antigenics Therapeutics Limited 11/04/2005 EU/3/05/271 Paromomycin sulphate Treatment of

visceral leishmaniasis OneWorld Health 11/04/2005 EU/3/05/272 Histamine dihydrochloride Treatement of acute myeloid leukaemia EpiCept GmbH 11/04/2005 EU/3/05/273 Ambrisentan Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension European Medical Advisory Services Limited 11/04/2005 EU/3/05/274 melatonin Non-24-Hour Sleep-Wake Disorder in blind people with no light perception ICON Clinical Research (UK)

Limited 11/04/2005 EU/3/05/275 Estradiol Hemihydrate and Progesterone Prevention of bronchopulmonary dysplasia in premature neonates of less than 30 weeks of gestational age B. Braun Melsungen AG 11/04/2005 EU/3/05/276 Humanized Agonistic Anti-CD28 Monoclonal Antibody Treatment of B-cell Chronic Lymphocytic Leukaemia (B-CLL) TeGenero AG 11/04/2005 EU/3/05/277 3-[5-(2-fluoro-phenyl)-[1,2,4]oxadiazole-3-yl]-benzoic acid Treatment of cystic fibrosis Voisin Consulting S.A.R.L. 27/05/2005 EU/3/05/278 3-[5-(2-fluoro-phenyl)-[1,2,4]oxadiazole-3-yl]-benzoic acid Treatment of Duchenne muscular dystrophy Voisin Consulting S.A.R.L. 27/05/2005 EU/3/05/278 3-[5-(2-fluoro-phenyl)-[1,2,4]oxadiazole-3-yl]-benzoic acid Treatment of Duchenne muscular dystrophy Voisin Consulting S.A.R.L. 27/05/2005 EU/3/05/279 (E)-(1S,4S,10S,21R)-7-[(Z)-ethylidene]-4,21-diisopropyl-2-oxa-12,13-dithia-5,8,20,23-tetraazabicyclo[8.7.6]tricos-16-ene-3,6,9,19,22-pentone Treatment of cutaneous T-cell lymphoma The s Consultancy Ltd 27/05/2005 EU/3/05/280 Acadesine Treatment of B-cell chronic lymphocytic leukemia (B-CLL) Advanced In Vitro Cell Technologies (Advancell) 27/05/2005 EU/3/05/282 miltefosine

Treatment of Acanthamoeba keratitis Laboratoires Théa 27/05/2005 EU/3/05/283 Recombinant megakaryopoeisis-stimulating protein Treatment of idiopathic thrombocytopenic purpura Amgen Europe B.V. 27/05/2005 EU/3/05/284 Sodium butyrate (rectal use) Prevention of radiation proctitis Promefarm srl 27/05/2005 EU/3/05/285 Bimosiamose disodium Treatment of acute lung injury Revotar Biopharmaceuticals AG 27/05/2005 EU/3/05/286 N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole Treatment of multiple myeloma Dr Geoffrey Allan 20/06/2005 EU/3/05/287 Bovine bile extract Treatment of pancreatic cancer Dr Ulrich Granzer 20/06/2005 EU/3/05/288 4-[3-(methylsulfonyl)phenyl]-1-propylpiperidine x HC1 Treatment of Huntington’s disease NeuroSearch Sweden AB 20/06/2005 EU/3/05/289 Pegylated arginine deiminase Treatment of hepatocellular carcinoma Dr Francesco Izzo 20/06/2005 EU/3/05/290 Humanised antibody fragment (Ep-CAM)-truncated Pseudomonas exotoxin A fusion protein Treatment of Ep-CAM-positive squamous cell carcinoma of the head and neck Viventia Biotech (EU)

Limited 20/06/2005 EU/3/05/291 Human monoclonal antibody against HLA-DR Treatment of Hodgkin’s lymphoma GPC Biotech AG 16/06/2005 EU/3/05/292 H-D-Asp-D-Gln-D-Ser-D-Arg-D-Pro-D-Val-D-Gln-D-Pro-D-Phe-D-Leu-D-Asn-D-Leu-D-Thr-D-Thr-D-Pro-D-Arg-D-Lys-D-Pro-D-Arg-D-Pro-D-Pro-D-Arg-D-Arg-D-Arg-D-Gln-D-Arg-D-Arg-D-Lys-D-Lys-D-Arg-D-Gly-NH2 Treatment of acute sensorineural hearing loss (acute acoustic trauma, sudden deafness and surgery induced acoustic trauma) Laboratoire Auris SAS 16/06/2005 EU/3/05/293 nelarabine Treatment of acute lymphoblastic leukaemia Glaxo Group Limited 16/06/2005 AtrianceEU/1/07/403/... 22/08/2007 EU/3/05/294 Soluble yeast beta-1,3/1,6-glucan Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy Biotec Pharmacon ASA 16/06/2005 EU/3/05/295 Hepatitis C Immunoglobulin Prevention of recurrent hepatitis C virus induced liver disease in liver transplant recipients Biotest Pharma GmbH 8/07/2005 EU/3/05/295 Hepatitis C Immunoglobulin Prevention of

recurrent hepatitis C virus induced liver disease in liver transplant recipients Biotest Pharma GmbH 8/07/2005 EU/3/05/296 Hydrocortisone (modified release tablet) Treatment of congenital adrenal hyperplasia Professor JM Ross 27/07/2005 EU/3/05/297 Adeno-associated viral vector containing a modified U7-snRNA gene Treatment of Duchenne muscular dystrophy Généthon 27/07/2005 EU/3/05/297 Adeno-associated viral vector containing a modified U7-snRNA gene Treatment of Duchenne muscular dystrophy Généthon 27/07/2005 EU/3/05/298 Mycophenolate mofetil Treatment of Cushing’s syndrome secondary to ectopic ACTH secretion Laboratoire HRA Pharma 27/07/2005 EU/3/05/299 4-imino-1, 3-diazobicyclo-[3.1.0]-hexan-2-one Treatment of pancreatic cancer ICON Clinical Research (UK) Ltd 27/07/2005 EU/3/05/300 Nemorubicin hydrochloride Treatment of hepatocellular carcinoma Nerviano Medical Sciences Srl 28/07/2005 EU/3/05/301 Chimeric monoclonal antibody to shiga-toxin 1 and 2 Treatment of shiga-toxin producing bacterial infection. Albany Regulatory Consulting Ltd 26/08/2005 EU/3/05/302 Extract of Sorghum bicolour leaf, Pterocarpus osun stem, Piper guineense seed and Caryophylli flower Treatment of sickle cell disease Xechem UK Ltd 26/08/2005 EU/3/05/303 Human autologous mesenchymal adult stem cells extracted from adipose tissue Treatment of anal fistula Cellerix S.L. 26/08/2005 EU/3/05/304 Imatinib mesilate Treatment of acute lymphoblastic leukaemia Novartis Europharm Limited 26/08/2005 EU/3/05/305 Imatinib mesilate Treatment of dermatofibrosarcoma protuberans Novartis Europharm Limited 26/08/2005 EU/3/05/307 Mecasermin Treatment of primary growth hormone insensitivity syndrome Tercica Europe Limited 26/08/2005 EU/3/05/308 Sapropterin Treatment of hyperphenylalaninemia Dr Gunter Schaub 26/08/2005 EU/3/05/309 Sodium valproate Treatement of 5q muscular atrophy The Trust for Spinal Muscular Atrophy 26/08/2005 EU/3/05/310 Treprostinil diethanolamine (oral use) Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension United Therapeutics Europe Ltd 26/08/2005 EU/3/05/312 (1R, 2R, 4S)-4-{(2R) Treatment of soft tissue sarcoma Orphix Consulting GmbH 26/08/2005 EU/3/05/313 Autologous CD34+ cells transfected with retroviral vector containing adenosine deaminase gene Treatment of severe combined immunodeficiency (SCID) due to adenosine deaminase (ADA) deficiency Fondazione Telethon 26/08/2005 EU/3/05/314 (1R,2S) 6-bromo-alpha-[2-(dimethylamino)ethyl]-2-methoxy-alpha-(1-naphthyl)-beta-phenyl-3-quinolineethanol Treatment of tuberculosis Tibotec Pharmaceuticals Ltd. 26/08/2005 EU/3/05/315 (2S)-2-[(4R)-2-oxo-4-propyltetrahydro-1H-pyrrol-1-yl] butanamide Treatment of progressive myoclonic epilepsies UCB Pharma SA. 26/08/2005 EU/3/05/316 2-{4-[(5,6-diphenylpyrazin-2-yl)(isopropyl)amino]butoxy}-N-(methylsulfonyl)acetamide Treatment of pulmonary arterial hypertension and chronic thromoembolic pulmonary hypertension Nippon Shinyaku Co. Ltd 26/08/2005 EU/3/05/317 A mixture of anti-CD3 mAb (SPV-T3a)-ricin A chain fusion protein and anti-CD7 mAb (WT1)-ricin A chain fusion protein Treatment of graft-versus-host-disease Henogen S.A. 26/08/2005 EU/3/05/318 Recombinant modified vaccinia virus Ankara expressing tuberculosis antigen 85A Prevention of tuberculosis disease in BCG vaccinated individuals University of Oxford 28/10/2005 EU/3/05/319 Human Staphylococcus aureus immunoglobulin Treatment of Staphylococcus aureus bacteremia Biotest Pharma GmbH 28/10/2005 EU/3/05/320 Imatinib mesilate Treatment of chronic eosinophilic leukaemia and the hypereosinophilic syndrome Novartis Europharm Limited 28/10/2005 EU/3/05/321 (1R,2R,4S)-4-{(2R)-2-[(3S,6R,7E,9R,10R,12R,14S,15E,17E,19E,21S,23S,26R,27R,34aS)-9,27-dihydroxy-10,21-dimethoxy-6,8,12,14,20,26-hexamethyl-1,5,11,28,29-pentaoxo-1,4,5,6,9,10,11,12,13,14,21,22,23,24,25,26,27,28,29,31,32,33,34,34a-tetra-cosah Treatment of primary malignant bone tumours Orphix Consulting GmbH 28/10/2005 EU/3/05/322 Alfimeprase Treatment of acute peripheral arterial occlusion Quadramed Limited 28/10/2005 EU/3/05/323 Bacterial lipase Treatment of malabsorption due to exocrine pancreatic enzyme insufficiency Nordmark Arzneimittel GmbH u. Co. KG 7/11/2005 EU/3/05/324 Levamisol hydrochloride Treatment of nephrotic syndrome Addmedica 28/10/2005 EU/3/05/325 Mannitolum Treatment of cystic fibrosis Pharmaxis Pharmaceuticals Limited 7/11/2005 EU/3/05/326 Peptide 144 TGF-beta1-inhibitor (TSLDASIIWAMMQN) Treatment of Systemic Sclerosis Digna Biotech S.L. 28/10/2005 EU/3/05/327 Oligonucleotide phosphorothioate (TAAACGTTATAACGTTATGACGTCAT), sodium salt Treatment of glioma Oligovax 28/10/2005 EU/3/05/328 (E)-(1S,4S,10S,21R)-7-[(Z)-ethylidene]-4,21-diisopropyl-2-oxa-12,13-dithia-5,8,20,23-tetraazabicyclo[8.7.6]tricos-16-ene-3,6,9,19,22-pentone Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) The s Consultancy Ltd 28/10/2005 EU/3/05/329 Peptide 144 TGF-beta1-inhibitor (TSLDASIIWAMMQN) Treatment of the localised scleroderma Digna Biotech S.L. 28/10/2005 EU/3/05/330 Tilarginine acetate Treatment of cardiogenic shock Dr Ulrich Granzer 18/10/2005 EU/3/05/331 Recombinant microbial lipase Treatment of malasbsorption due to exocrine pancreatic enzyme insufficiency Solvay Pharmaceuticals GmbH 28/10/2005 EU/3/05/332 1,2-bis(methylsulphonyl)-1-(2-chloroethyl)-2-[(methylamino)carbonyl]hydrazine Treatment of acute myeloid leukaemia Vion (UK) Limited, ? i3 Research 14/12/2005 EU/3/05/333 Eptacog alfa (activated) Treatment of diffuse alveolar haemorrhage Pharmaorigin ApS 14/12/2005 EU/3/05/334 Human immunoglobulin G1 constant region – human ectodysplasin-A1 receptor-binding domain fusion protein Treatment of X-linked hypohidrotic ectodermal dysplasia (Christ-Siemens-Touraine Syndrome) Apoxis (UK) Ltd 14/12/2005 EU/3/05/336 Brostallicin Treatment of soft tissue sarcoma Nerviano Medical Sciences Srl 23/12/2005 EU/3/05/337 Heparin sodium (inhalation use) Treatment of cystic fibrosis Vectura Group plc 23/12/2005 EU/3/05/338 Dasatinib Treatment of acute lymphoblastic leukaemia Bristol-Myers Squibb Pharma EEIG 23/12/2005 EU/3/05/339 Dasatinib Treatment of chronic myeloid leukaemia Bristol-Myers Squibb Pharma EEIG 23/12/2005 SprycelEU/1/06/363/... 20/11/2006 EU/3/05/340 Imatinib mesilate Treatment of myelodysplastic / myeloproliferative diseases Novartis Europharm Limited 23/12/2005 EU/3/05/341 Imexon Treatment of ovarian cancer ICON Clinical Research (UK) Ltd 23/12/2005 EU/3/05/342 Denufosol tetrasodium Treatment of cystic fibrosis Envestia Limited 23/12/2005 EU/3/05/343 Enzastaurin hydrochloride Treatment of glioma Eli Lilly Nederland B.V. 23/12/2005 EU/3/05/344 Vandetanib Treatment of medullary thyroid carcinoma AstraZeneca UK

Limited 24/01/2006 EU/3/05/345 Lentiviral vector containing the human Wiskott Aldrich syndrome protein gene Treatment of Wiskott-Aldrich syndrome Généthon 24/01/2006 EU/3/05/346 E. Coli heat-shock protein 70 with bovine retinal S-antigen Treatment of autoimmune uveitis Biotech Tools SA 24/01/2006 EU/3/05/347 Human monoclonal antibody against HLA-DR Treatment of chronic lymphocytic leukaemia GPC Biotech AG 24/01/2006 EU/3/05/348 Purified inactivated Japanese encephalitis SA14-4-2 virus vaccine Prevention of Japanese encephalitis Intercell AG 24/01/2006 EU/3/06/349 Apomorphine hydrochloride (inhalation use) Treatment of off-periods in Parkinson’s disease not

responding to oral treatment Vectura Group plc 16/02/2006 EU/3/06/350 Alpha-1 proteinase inhibitor Treatment of emphysema secondary to congenital alpha-1 antitrypsin deficiency Octapharma (IP) Limited 16/02/2006 EU/3/06/351 Miglustat Treatment of Niemann-Pick Disease, type C Actelion Registration Ltd 16/02/2006 EU/3/06/352 26 base single stranded phosphodiester DNA oligonucleotide Treatment of pancreatic cancer Antisoma Research Ltd 16/02/2006

EU/3/06/353 26 base single stranded phosphodiester DNA oligonucleotide Treatment of renal cell carcinoma Antisoma Research Ltd 16/02/2006 EU/3/06/354 Oxalobacter formigenes strain HC-1 Treatment of primary hyperoxaluria OxThera AB 17/02/2006 EU/3/06/355 Zosuquidar trihydrochloride Treatment of acute myeloid leukaemia Kanisa Europe Limited, Mofo Notices Limited, C/on & Foerster MNP 17/02/2006 EU/3/06/356 4-amino-5-oxo-4 (pyridinium-1-ylmethyl) proline Treatment of renal cell carcinoma Prodimed S.A. 16/02/2006 EU/3/06/357 2’-O-methyl-phosphorothioate oligonucleotide Treatment of Duchenne muscular dystrophy Prosensa B.V. 16/02/2006 EU/3/06/357 2’-O-methyl-phosphorothioate oligonucleotide Treatment of Duchenne muscular dystrophy Prosensa B.V. 16/02/2006 EU/3/06/358 Human monoclonal antibody against HLA-DR Treatment of multiple myeloma GPC Biotech AG 28/02/2006 EU/3/06/359 Adeno associated viral vector containing the human calpain 3 gene Treatment of calpainopathy Généthon 6/04/2006 EU/3/06/360/ Ciclosporin Treatment of vernal keratoconjunctivitis Novagali Pharma SA 6/04/2006 EU/3/06/361 Glutathione Treatment of cystic fibrosis Mukoviszidose e.V. 11/04/2006 EU/3/06/362 Human heterologous liver cells (for infusion) Treatment of acute liver failure Cytonet GmbH & Co. KG 11/04/2006 EU/3/06/363 4-[131I]iodo-L-phenylalanine Treatment of glioma Therapeia GmbH & Co. KG 11/04/2006 EU/3/06/364 Sorafenib tosylate Treatment of hepatocellular carcinoma Bayer HealthCare AG 11/04/2006 EU/3/06/365 Temsirolimus Treatment of renal cell carcinoma Wyeth Europa Limited 6/04/2006 TORISELEU/1/07/424/... 19/11/2007 EU/3/06/366 Tobramycin (liposomal) Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis EUCRO GmbH & Co. KG

11/04/2006 EU/3/06/367 Parathyroid hormone (1-34) transglutaminase fusion protein fibrin matrix complex Treatment of solitary bone cysts Kuros Biosurgery International AG 11/04/2006 EU/3/06/368 1-deoxygalactonojirimycin hydrochloride Treatment of Fabry disease Amicus Therapeutics UK Limited 22/05/2006 EU/3/06/369 Bilayer engineered skin composed of keratinocytes from the patient (autologous) and fibroblasts from a donor (allogeneic) embedded in a plasma matrix Treatment of epidermolysis bullosa Cellerix S.L. 22/05/2006 EU/3/06/370 Decitabine Treatment of acute myeloid leukaemia Janssen-Cilag International NV 8/06/2006 EU/3/06/371 Heparin sodium Treatment of cystic

fibrosis Ockham Biotech Limited 22/05/2006 EU/3/06/372 Hydrocortisone (modified release tablet) Treatment of adrenal insufficiency DuoCort AB 22/05/2006 EU/3/06/373 Mecasermin Treatment of primary insulin-like growth factor-1 deficiency due to molecular or genetic defects Tercica Europe Limited 22/05/2006 EU/3/06/374 Methoxsalen Treatment of Graft-versus-Host disease & Medical Ltd 22/05/2006 EU/3/06/375 Nilotinib Treatment of chronic myeloid leukaemia Novartis Europharm Limited 22/05/2006 EU/3/06/376 Recombinant P-selectin glycoprotein immunoglobulin

Prevention of post transplantation graft dysfunction RJM Consultancy Ltd 22/05/2006 EU/3/06/379 Diphenylcyclopropenone Treatment of alopecia totalis Orfagen 29/06/2006 EU/3/06/380 Diphenylcyclopropenone Treatment of alopecia universalis Orfagen 29/06/2006 EU/3/06/381 Human monoclonal antibody against Pseudomonas aeruginosa serotype O11 Treatment of pneumonia caused by serotype O11 Pseudomonas aeruginosa Voisin Consulting 29/06/2006 EU/3/06/382 Pazopanib hydrochloride Treatment of renal cell carcinoma GlaxoKline Research & Development Limited 29/06/2006 EU/3/06/383 Siplizumab Treatment of T-cell and NK-cell neoplasms MedImmune Oncology, Inc. 29/06/2006 EU/3/06/384 Human telomerase reverse transcriptase peptide (611-626) Treatment of pancreatic cancer Pharmexa A/S 25/07/2006 EU/3/06/385 2-(4-(diethylamino) phenyl)-6-methyl-2H-benzo[d][1,2,3] triazol-5-amine Treatment of Duchenne muscular dystrophy Vastox plc. 25/07/2006 EU/3/06/385 2-(4-(diethylamino) phenyl)-6-methyl-2H-benzo[d][1,2,3] triazol-5-amine Treatment of Duchenne muscular dystrophy Vastox plc. 25/07/2006 EU/3/06/386 4-[123I]iodo-L-phenylalanine diagnosis of glioma Therapeia GmbH & Co. KG 25/07/2006 EU/3/06/387 Amikacin sulfate (liposomal) ?reatment of Pseudomonas aeruginosa lung infection in cystic fibrosis & Bockius 25/07/2006 EU/3/06/388 Becatecarin Treatment of cancers of the biliary tree Helsinn Birex Pharmaceuticals Ltd 25/07/2006 EU/3/06/389 Lestaurtinib Treatment of acute myeloid leukaemia Cephalon Europe 25/07/2006 EU/3/06/390 4-amino-(6R,S)-5,6,7,8-tetrahydro-L-biopterin dihydrochloride Treatment of moderate and severe traumatic brain injury vasopharm BIOTECH GmbH 28/08/2006 EU/3/06/391 Amphotericin B (for inhalation use) Prevention of pulmonary fungal infection in patients deemed at risk Nektar Therapeutics UK Ltd 28/08/2006 EU/3/06/392 Human monoclonal antibody against inhibitory killer cell lg-like receptors Treatment of acute myeloid leukaemia Novo Nordisk A/S 28/08/2006 EU/3/06/394 Autologous tumor-derived immunoglobulin idiotype coupled to keyhole limpet haemocyanin Treatment of follicular lymphoma Analytica International GmbH 28/08/2006 EU/3/06/395 Aviptadil Treatment of acute lung injury mondoBIOTECH Laboratories Anstalt 28/08/2006 EU/3/06/396 Cardiotrophin-1 Prevention of the ischemia/reperfusion injury associated with

solid organ transplantation Digna Biotech S.L. 28/08/2006 EU/3/06/397 Cholest-4-en-3-one, oxime Treatment of amyotrophic lateral sclerosis Trophos SA 28/08/2006 EU/3/06/398 H-Val-Ile-Val-Lys-Leu-Ile-Pro-Ser-Thr-Ser-Ser-Ala-Val-Asp-Thr-Pro-Tyr-Leu-Asp-Ile-Thr-Tyr-His-Phe-Val-Ala-Gln-Arg-Leu-Pro-Leu-OH Treatment of myasthenia gravis Debioclinic SA 28/08/2006 EU/3/06/399 Mecasermin rinfabate Prevention of retinopathy of prematurity in neonates of less than 32 weeks of gestational age Premacure AB 28/08/2006 EU/3/06/400 Metastable technetium 99 [99mTc] demogastrin 2 Diagnosis of medullary thyroid carcinoma Biomedica Life Sciences S.A. 28/08/2006 EU/3/06/401 N-methyl D-(2,3,4,5,6-pentahydroxy-hexyl)-ammonium; 2-(3,5-dichloro-phenyl)-benzoxazole-6-carboxylate Treatment of familial amyloid polyneuropathy ICON Clinical Research (UK) Ltd 28/08/2006 EU/3/06/402 Opebacan Treatment of meningococcal disease XOMA Ireland Ltd 28/08/2006 EU/3/06/403 5-(2,6-Difluoro-phenoxy)-3(R,S)-{2(S)-[2(S)-(3-methoxycarbonyl-2(S)-{3-methyl-2(S)-[(quinoline-2-carbonyl)-amino]-butyrylamino}-propionylamino)-3-methyl-butyrylamino]-propionylamino}-4-oxo-pentanoic acid methyl ester Treatment of neonatal brain injury Theraptosis 23/10/2006 EU/3/06/404 Adenoviral vector containing human p53 gene Treatment of Li Fraumeni Syndrome Gendux Molecular Limited 23/10/2006 EU/3/06/405 Genetically modified allogeneic (human) tumour cells for the expression of IL-7, GM-CSF, CD80 and CD154, in fixed combination with a DNA-based double stem loop immunomodulator (dSLIM) Treatment of renal cell

carcinoma MOLOGEN AG 23/10/2006 EU/3/06/406 Arimoclomol Treatment of amyotrophic lateral sclerosis Wainwright Associates Ltd 26/10/2006 EU/3/06/407 Heparin-binding epidermal growth factor-like growth factor (HB-EGF), amino acids 74-148 Prevention of necrotizing enterocolitis Dr 31/10/2006 EU/3/06/408 Human cytomegalovirus immunoglobulin Prevention of congenital cytomegalovirus infection following primary cytomegalovirus infection Biotest Pharma GmbH 31/10/2006 EU/3/06/409 L-asparaginase encapsulated in erythrocytes Treatment of acute lymphoblastic leukaemia Erytech Pharma S.A. 27/10/2006 EU/3/06/410 Doxorubicin hydrochloride (liposomal) Treatment of soft tissue sarcoma GP-Pharm S.A. 27/10/2006 EU/3/06/411 Recombinant fusion protein consisting of the extracellular portion of CD95 fused to the Fc part of a human IgG1 molecule Prevention of Graft-versus-Host disease Apogenix GmbH 31/10/2006 EU/3/06/412 4,7,10,13,16,19-docosahexaenoic acid Treatment of retinitis pigmentosa Cela 3/11/2006 EU/3/06/413 Budesonide (oral use) Treatment of Graft-versus-Host disease Dr Falk, Pharma GmbH 3/11/2006 EU/3/06/414 Catumaxomab Treatment of gastric cancer Fresenius Biotech GmbH 3/11/2006 EU/3/06/415 Ciclosporin (implant) Prevention of rejection of corneal transplant Lux Biosciences GmbH 3/11/2006 EU/3/06/416 Antisense oligonucleotide 5'-d[P-Thio](CCCTG CTCCC CCCTG GCTCC)-3' Treatment of acute myeloid leukaemia EleosInc Limited 3/11/2006 EU/3/06/417 Human Interleukin-2 (glycosylated tetrasaccharide, glycosylated trisaccharide and non-glycosylated) (inhalation use) Treatment of renal cell carcinoma Immunservice GmbH 27/10/2006 EU/3/06/418 Iodine (131I) anti-tenascin monoclonal antibody 81C6 Treatment of glioma The Weinberg Group LLC 30/10/2006 EU/3/06/419 Paclitaxel (liposomal) Ttreatment of pancreatic cancer MediGene AG 31/10/2006 EU/3/06/420 Temsirolimus Treatment of mantle cell lymphoma Wyeth Europa Limited 6/11/2006 EU/3/06/421 Forodesine hydrochloride Treatment of acute lymphoblastic leukaemia Napp Pharmaceuticals Research Limited 18/12/2006 EU/3/06/422 Paclitaxel (micellar) Treatment of ovarian cancer Oasmia Pharmaceutical AB 18/12/2006 EU/3/06/423 Tazarotene Treatment of congenital ichthyoses Orfagen 18/12/2006 EU/3/06/424 Thiotepa Conditioning treatment prior to haematopoietic progenitor cell transplantation Adienne S.r.l. 29/01/2007 EU/3/06/425 Complement factor H Treatment of atypical Haemolytic Uraemic Syndrome (aHUS) associated

with an inherited abnormality of the complement system Laboratoire français du Fractionnement et des Biotechnologies (LFB) 26/01/2007 EU/3/06/426 Fenretinide Treatment of primary malignant bone tumours Cancer Research UK 26/01/2007 EU/3/06/427 Fenretinide Treatment of soft tissue sarcoma Cancer Research UK 30/01/2007 EU/3/06/428 Forodesine hydrochloride Treatment of cutaneous T-cell lymphoma Napp Pharmaceuticals Research Limited 29/01/2007 EU/3/06/429 Recombinant modified vaccinia Ankara expressing human 5T4 Treatment of renal cell carcinoma Oxford Biomedica (UK) Ltd 26/01/2007 EU/3/07/430 artesunate Treatment of

malaria Pharmaorigin ApS 20/02/2007 EU/3/07/431 Autologous dendritic cells pulsed with autologous tumour cell lysate Treatment of glioma Dorian Regulatory Affairs BV 15/02/2007 EU/3/07/432 Ex-vivo cultured adult human mesenchymal stem cells Treatment of Graft-versus-Host disease Quintiles UK Limited 20/02/2007 EU/3/07/433 HLA class I/II binding tumour associated peptides (ADF-APO-CCN-GUC-K67-MET- MMP-MUC-RGS) Treatment of renal cell carcinoma Immatics Biotechnologies GmbH 15/02/2007 EU/3/07/434 Idebenone Treatment of Leber's hereditary optic neuropathy Santhera Pharmaceuticals (Deutschland) GmbH 15/02/2007 EU/3/07/435 Recombinant human C1-inhibitor Prevention of delayed graft function after solid organ transplantation Pharming Group N.V. 20/02/2007 EU/3/07/436 Eptacog alfa (activated) Treatment of post-neonatal intracerebral haemorrhage Novo Nordisk A/S 20/03/2007 EU/3/07/437 Idebenone Treatment of Duchenne muscular dystrophy Santhera Pharmaceuticals (Deutschland) GmbH 20/03/2007 EU/3/07/437 Idebenone Treatment of Duchenne muscular dystrophy Santhera

Pharmaceuticals (Deutschland) GmbH 20/03/2007 EU/3/07/438 Zanolimumab Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Genmab A/S 20/03/2007 EU/3/07/439 Recombinant human monoclonal antibody to human IL-1beta of the IgG1/K class Treatment of cryopirin-associated periodic syndromes (Familial Cold Urticaria Syndrome (FCUS), Muckle-Wells Syndrome (MWS), and Neonatal Onset Multisystem Inflammatory Disease (NOMID), also known as Chronic Infantile Neurological Cutaneous Novartis Europharm Limited 20/03/2007 EU/3/07/440 Recombinant adeno-associated viral vector containing human alpha-1 antitrypsin gene Treatment of congenital alpha-1 antitrypsin deficiency The s Consultancy Ltd 20/03/2007 EU/3/07/441 Hydrocortisone (modified release tablet) Treatment of adrenal insufficiency Phoqus Pharmaceuticals Ltd 20/03/2007 EU/3/07/442 Enzastaurin hydrochloride Treatment of diffuse large B cell lymphoma Eli Lilly Nederland B.V. 20/03/2007 EU/3/07/443 Elafin Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Proteo Biotech AG 20/03/2007 EU/3/07/444 Pralatrexate Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Organon N.V. 13/04/2007 EU/3/07/445 Antisense

oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) Prevention of corneal graft rejection Gene Signal SAS 17/04/2007 EU/3/07/446 Autologous CD34+ cells transfected with lentiviral vector containing the human arylsulfatase A cDNA Treatment of metachromatic leukodystrophy Fondazione Telethon 13/04/2007 EU/3/07/447 Nilotinib hydrochloride monohydrate Treatment of gastro intestinal stromal tumours Novartis Europharm Limited 13/04/2007 TasignaEU/1/07/422/... 19/11/2007 EU/3/07/448 Talactoferrinum alfa Treatment of renal cell carcinoma Agennix Limited 5/06/2007 EU/3/07/449 everolimus Treatment of renal cell carcinoma Novartis Europharm Limited 5/06/2007 EU/3/07/450 5(S)-(2´-hydroxy ethoxy)-20(S)- camptothecin Treatment of osteosarcoma ClinTec International Ltd 8/06/2007 EU/3/07/451 Cisplatin (liposomal) Treatment of pancreatic cancer Regulon AE 8/06/2007 EU/3/07/452 R-1-[2,3-dihydro-2-oxo-1-pivaloylmethyl-5-(2-pyridyl)-1 H-1,4-benzodiazepin-3-yl]-3-(3-methylaminophenyl)urea Treatment of gastric carcinoid Trio Medicines Ltd 14/06/2007 EU/3/07/453 Recombinant fusion protein consisting of human coagulation factor IX attached to the Fc domain of human IgG1 Treatment of haemophilia B (congenital factor IX deficiency) Biovitrum AB 8/06/2007 EU/3/07/454 Recombinant adeno-associated viral vector containing human acid alpha-glucosidase-gene Treatment of glycogen storage disease type II

(Pompe's disease) The s Consultancy Ltd 9/07/2007 EU/3/07/455 Ciclosporin Prevention of corneal graft rejection Novagali Pharma SA 22/10/2007 EU/3/07/456 Rilonacept Treatment of cryopirin-associated periodic syndromes (Familial Cold Urticaria Syndrome (FCUS), Muckle-Wells Syndrome (MWS), and Neonatal Onset Multisystem Inflammatory Disease (NOMID), also known as Chronic Infantile Neurological Cutaneous Articular Syndrome (CINCA) Regeneron UK Limited 10/07/2007 EU/3/07/457 Lusupultide Treatment of aspiration pneumonitis requiring intubation and mechanical ventilation ALTANA Pharma AG 10/07/2007 EU/3/07/458 fampridine Treatment of Guillain-Barré syndrome Dr Ulrich Granzer 10/07/2007 EU/3/07/459 1-{3-[3-(4-chlorophenyl)propoxy]propyl}piperidine, hydrochloride Treatment of narcolepsy Bioprojet 10/07/2007 EU/3/07/460 Arsenic trioxide Treatment of acute myeloid leukaemia Cephalon Europe 2/08/2007 EU/3/07/461 Human plasminogen Treatment of ligneous conjunctivitis Kedrion S.p.A. 3/08/2007 EU/3/07/462 Recombinant human soluble Fc-gamma receptor Iib Treatment of idiopathic

thrombocytopenic purpura SuppreMol GmbH 2/08/2007 EU/3/07/463 Pyridoxalated haemoglobin polyoxyethylene Treatment of cardiogenic shock Curacyte AG 2/08/2007 EU/3/07/464 Panobinostat lactate Treatment of cutaneous T-cell lymphoma Novartis Europharm Limited 2/08/2007 EU/3/07/465 L-threo-3,4-dihydroxyphenylserine Treatment of orthostatic hypotension in patients with pure autonomic failure The Weinberg Group LLC 2/08/2007 EU/3/07/466 L-threo-3,4-dihydroxyphenylserine Treatment of orthostatic hypotension in patients with multiple system atrophy The Weinberg Group LLC 2/08/2007 EU/3/07/467 Eltrombopag

olamine Treatment of idiopathic thrombocytopenic purpura GlaxoKline Research & Development Limited 3/08/2007 EU/3/07/468 Dihydroartemisinin, piperaquine Treatment of malaria Sigma Tau Industrie Farmaceutiche Riunite S.p.A 3/08/2007 EU/3/07/469 Ciprofloxacin (inhalation use) Treatment of cystic fibrosis Bayer HealthCare AG 3/08/2007 EU/3/07/470 Human heterologous liver cells (for infusion) Treatment of ornithine-transcarbamylase deficiency Cytonet GmbH & Co. KG 14/09/2007 EU/3/07/471 Human coagulation factor X Treatment of hereditary factor X deficiency Bio Products Laboratory 17/09/2007 EU/3/07/472 Cyclo

{{(E,Z)-(2S,3R,4R)-3-hydroxy-4-methyl-2-(methylamino)nona-6,8-dienoyl}-L-2-aminobutyryl-N-methyl-glycyl-N-methyl-L-leucyl-L-valyl-N-methyl-L-leucyl-L-alanyl-D-alanyl-N-methyl-L-leucyl-N-methyl-L-leucyl-N-methyl-L-valyl} Treatment of chronic non-infectious uveitis Lux Biosciences GmbH 14/09/2007 EU/3/07/473 Aviptadil Treatment of sarcoidosis mondoBIOTECH Laboratories Anstalt 14/09/2007 EU/3/07/474 Alpha-1 proteinase inhibitor (inhalation use) Treatment of cystic fibrosis CSL Behring GmbH 14/09/2007 EU/3/07/475 Alginate oligosaccharide (G-block) fragment Treatment of cystic fibrosis AlgiPharma AS 14/09/2007 EU/3/07/476 5´-O-(trans-9´-octadecenoyl)-1-ß-D-arabinofuranosyl cytosine Treatment of acute myleoid leukaemia Clavis Pharma ASA 14/09/2007 EU/3/07/477 4-Amino-1-[5-O-[(2R,4S)-2-oxido-4-(4-pyridinyl)-1,3,2-dioxaphosphorinan-2-yl]-ß-D-arabinofuranosyl]-2(1H)-pyrimidinone Treatment of hepatocellular carcinoma Interface International Consultancy Limited 14/09/2007 EU/3/07/478 N-(2-amino-phenyl)-4-[(4-pyridin-3-yl-pyrimidin-2-ylamino)-methyl] benzamide Treatment of Hodgkin

lymphoma Pharmion Limited 14/09/2007 EU/3/07/479 N-adamantanyl-N'-geranyl-ethylenediamine Treatment of tuberculosis RLM Consulting 14/09/2007 EU/3/07/480

Naptumomab estafenatox Treatment of renal cell carcinoma Active Biotech Research AB 14/09/2007 EU/3/07/481 R-salbutamol sulphate Treatment of cutaneous forms of lupus erythematosus Astion Pharma A/S 14/09/2007 EU/3/07/482 Sulfonated monophosphorylated mannose oligosaccharide Treatment of hepatocellular carcinoma Constella Group Ltd 14/09/2007 EU/3/07/483 Amonafide L-malate Treatment of acute myeloid leukaemia INC Research UK Ltd 22/10/2007 EU/3/07/484 Adenovirus associated viral vector serotype 4 containing the human RPE65 gene Treatment of Leber's congenital amaurosis Centre Hospitalier Universitaire de Nantes 22/10/2007 EU/3/07/485 Alvocidib Treatment of chronic lymphocytic leukaemia Sanofi Aventis 23/10/2007 EU/3/07/486 Adenovirus associated viral vector serotype 4 containing the human RPE65 gene Treatment of retinitis pigmentosa Centre Hospitalier Universitaire de Nantes 14/11/2007 EU/3/07/487 4-ethoxy-2-(piperazin-1-yl)-7-(pyridin-4-yl)-5H-pyrimido[5,4-b]indol Treatment of chronic lymphocytic leukaemia Curacyte Discovery GmbH 14/11/2007 EU/3/07/488 everolimus Treatment of gastro-entero-pancreatic neuroendocrine tumours Novartis Europharm Limited 14/11/2007 EU/3/07/489 Ciclosporin Treatment of Herpes simplex virus stromal keratitis Novagali Pharma SA 29/10/2007 EU/3/07/490 Human autologous bone-forming cells derived from bone marrow stem cells Treatment of non-traumatic osteonecrosis Bone Therapeutics SA 29/10/2007 EU/3/07/491 Interferon gamma Treatment of idiopathic pulmonary fibrosis Foundation For Fatal Rare

Diseases 29/10/2007 EU/3/07/492 Iodine (131I) chlorotoxin Treatment of glioma The Weinberg Group LLC 22/10/2007 EU/3/07/493 Isofagomine tartrate Treatment of Gaucher Disease Amicus Therapeutics UK Limited 23/10/2007 EU/3/07/494 Lenalidomide Treatment of chronic lymphocytic leukaemia Celgene Europe Limited 19/11/2007 EU/3/07/495 Methotrexate (oral liquid) Treatment of acute lymphoblastic leukaemia Only for Children Pharmaceuticals 24/10/2007 EU/3/07/496 Mercaptopurine (oral liquid) Treatment of acute lymphoblastic leukaemia Only for Children Pharmaceuticals 22/10/2007 EU/3/07/497 4-[3,5-bis(trimethylsilyl)benzamido]benzoic acid Treatment of hepatocellular carcinoma Quintiles Ireland Ltd 22/10/2007 EU/3/07/498 Polihexanide Treatment of Acanthamoeba keratitis S.I.F.I. Società Industria Farmaceutica Italiana S.p.A. 14/11/2007 EU/3/07/499 Terguride Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Ergonex Licensing and Regulatory Services AG 29/11/2007 EU/3/07/500 Recombinant human rod-derived cone viability factor Treatment of retinitis pigmentosa Fovea Pharmaceuticals SA 29/11/2007 EU/3/07/501 Olaparib Treatment of ovarian cancer AstraZeneca AB 6/12/2007 EU/3/07/502 Picoplatin Treatment of small cell lung cancer Kendle International Ltd 6/12/2007 EU/3/07/503 Recombinant human hepatitis C

monoclonal antibody against C4 region of E1 Prevention of recurrent hepatitis C virus induced liver disease in liver transplant recipients GENimmune N.V 6/12/2007 EU/3/07/503 Recombinant human hepatitis C monoclonal antibody against C4 region of E1 Prevention of recurrent hepatitis C virus induced liver disease in liver transplant recipients GENimmune N.V 6/12/2007 EU/3/07/504 Irinotecan hydrochloride (drug eluting beads) Treatment of glioma CellMed AG 29/11/2007 EU/3/07/505 Interferon beta Treatment of acute lung

injury Faron Pharmaceuticals Limited 29/11/2007 EU/3/07/506 Heterologous human adult liver derived stem cells Treatment of Crigler-Najjar syndrome Prof. Etienne Sokal 29/11/2007 EU/3/07/507 Doxorubicin hydrochloride (drug eluting beads) Treatment of glioma CellMed AG 29/11/2007 EU/3/07/508 Chimeric-anti-interleukin-6 monoclonal antibody Treatment of Castleman’s disease Centocor B.V. 30/11/2007 EU/3/07/509 Azacitidine Treatment of acute myeloid leukaemia Pharmion Limited 29/11/2007 EU/3/07/510 artesunate Treatment of malaria Sigma-tau Pharma UK 6/12/2007 EU/3/07/511 3-methoxy-pregnenolone Treatment of spinal cord injury MAPREG SAS 4/12/2007 EU/3/07/512 17-(allylamino)-17-demethoxygeldanamycin hydroquinone hydrochloride Treatment of malignant gastro intestinal stromal tumours MedImmune Oncology, Inc. 29/11/2007 EU/3/07/513 (S)-2-nitro-6-(4-(trifluoromethoxy)benzyloxy)-6,7-dihydro-5H-imidazo[2,1-b][1,3]oxazine Treatment of tuberculosis Dr Ulrich Granzer 29/11/2007 EU/3/07/514 (1R, 2R)-Octanoic acid [2-(2’,3’-dihydro-benzo [1,4] dioxin-6’-yl)-2-hydroxy-1-pyrrolidin-1-ylmethyl-ethyl]-amide-L-tartaric acid salt Treatment of Gaucher Disease Genzyme Europe BV 4/12/2007 EU/3/07/515 Tegafur, gimeracil, oteracil

potassium Treatment of gastric cancer Sanofi Aventis 20/12/2007 EU/3/07/516 Recombinant human histone H1.3 and recombinant human N-bis-met-histone H1.3 Treatment of acute myeloid leukaemia SymbioTec GmbH 20/12/2007 EU/3/07/517 N-[4-(3-amino-1H-indazol-4-yl)phenyl]-N´-(2-fluoro-5-methylphenyl) urea Treatment of hepatocellular carcinoma Abbott Laboratories Limited 20/12/2007 EU/3/07/518 Methyl 4,6-diamino-2-[1-(2-fluorobenzyl)-1H-pyrazolo[3,4-b]pyridine-3-yl]-5-pyrimidinyl(methyl)carbamate Treatment of pulmonary

arterial hypertension including treatment of chronic thromboembolic pulmonary hypertension Bayer HealthCare AG 20/12/2007 EU/3/07/519 Maribavir Prevention of cytomegalovirus (CMV) disease in patients with impaired cell mediated immunity deemed at risk ViroPharma Limited 18/12/2007 EU/3/07/520 EU/3/07/520 Treatment of epithelial neoplasia of the vulva positive for human papilloma virus ISA Pharmaceuticals BV 20/12/2007 EU/3/07/521 H-Arg-Leu-Phe-Phe-Tyr-Arg-Lys-Ser-Val-OH, acetate salt & H-Tyr-Leu-Phe-Phe-Tyr-Arg-Lys-Ser-Val-OH, acetate salt Treatment of TERT

positive non-small cell lung cancer in HLA-A2 positive patients Vaxon Biotech 18/12/2007 EU/3/07/522 (manganese, dichloro [(4aR, 13aR, 17aR, 21aR)-1, 2, 3, 4, 4a, 5, 6, 12, 13, 13a, 14, 15, 16, 17, 17a, 18, 19, 20, 21, 21a-eicosahydro-11, 7-nitrilo-7H-dibenzo[ b,h] [1,4,7,10] tetraazacycloheptadecine-?N5, ?N13, ?N18, ?N21, ?N22]-) Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy Celtic Bio-Pharma Services Ltd 31/01/2008 EU/3/07/523 Lutetium (177Lu)-N-[(4,7,10-Tricarboxymethyl-1,4,7,10-tetraazacyclododec-1-yl)acetyl]-D-phenylalanyl-L-cysteinyl-L-tyrosyl-D-tryptophanyl-L-lysyl-L-threoninyl-L-cysteinyl-L-threonine-cyclic(2-7)disulfide Treatment of gastro-entero-pancreatic neuroendocrine tumours BioSynthema Global Operations B.V 31/01/2008 EU/3/07/524 ®-2-Methyl-6-nitro-2-{4-[4-(4-trifluoromethoxyphenoxy)piperidin-1-yl]phenoxymethyl}-2,3-dihydroimidazo[2,1-b]oxazole Treatment of tuberculosis Otsuka Pharmaceutical Europe Ltd 1/02/2008 EU/3/07/525 Iodine (131I) iobenguane Treatment of neuroblastoma Molecular Insight Limited 31/01/2008 EU/3/07/526 N-(2-amino-phenyl)-4-[(4-pyridin-3-yl-pyrimidin-2-ylamino)-methyl] benzamide Treatment of acute myeloid leukaemia Pharmion Ltd 31/01/2008 EU/3/08/527 Recombinant human monoclonal antibody to human IL-1beta of the IgG1/K class Treatment of systemic-onset juvenile idiopathic arthritis Novartis Europharm Limited 4/02/2008 EU/3/08/528 Lumiliximab Treatment of chronic lymphocytic leukaemia Biogen Idec Limited 4/02/2008 EU/3/08/529 Tretazicar Treatment of visceral leishmaniasis Morvus Technology Limited 4/02/2008 EU/3/08/530 Heterologous human adult liver derived stem

cellsHeterologous human adult liver derived stem cells Treatment of ornithinine transcarbamylase deficiency Prof. Etienne Sokal 4/02/2008 EU/3/08/534 Allogeneic human umbilical cord tissue-derived cells Treatment of retinitis pigmentosa Centocor, B.V. 1/04/2008 EU/3/08/535 Humanised monoclonal antibody to the folate receptor alpha Treatment of ovarian cancer Chiltern International Limited 1/04/2008 EU/3/08/536 Chimeric antibody to mesothelin Treatment of pancreatic cancer Chiltern International Limited 17/03/2008 EU/3/08/537 Autologous urothelial and smooth muscle cells Treatment of spina bifida Choice Pharma Limited 17/03/2008 European Commission - Enterprise and Industry Directorate General - Consumer goods - Pharmaceuticals - Last update : 3/4/08 Regards, Dr Kiran Chaudhari Lecturer, Dept of Pharmacology, GMC, Nagpur.

From Chandigarh to Chennai - find friends all over India. Click here.