Genetic Variation Doubles Risk of Liver Cancer

[Guest guest]

Genetic Variation Doubles Risk of Liver Cancer

Testing could determine which cirrhosis patients should be screened

for tumor development

See full study article below following this News Report

WEDNESDAY, Jan. 2 (HealthDay News) -- A single change in the

epidermal growth factor (EFG) gene may double the risk of developing

liver tumors, especially among people with cirrhosis, new research

suggests.

Hepatocellular carcinoma is a liver tumor that is the third leading

cause of cancer death and may result from this genetic variation,

said the researchers. It is also the sixth most common solid tumor

worldwide and often develops in people who have cirrhosis.

Cirrhosis is a liver disease that can result from long-term alcohol

abuse or infection with the hepatitis C or B viruses. According to

the U.S. National Cancer Institute, about five percent of people with

cirrhosis will develop liver cancer.

The research, published in the Jan. 2 edition of the Journal of the

American Medical Association, suggested that people who have one or

two guanine nucleotides at the EFG gene site, instead of two adenine

nucleotides, are at significantly greater risk of cancer.

" If these results are confirmed, this EGF variation could be used to

determine which cirrhotic patients should be screened more

intensively for tumor development, " lead author Dr. Tanabe,

chief of surgical oncology at the Massachusetts General Hospital

Cancer Center, said in a prepared statement. " In addition, the

molecular pathway controlled by EGF and its receptor, EGFR, which is

known to be important in several types of cancer, appears to be an

excellent target for chemoprevention studies. This is a deadly

cancer, and so progress in prevention and early detection is

critically important. "

The EFG gene normally works to increase tissue growth through the

production of EFG protein. Animal studies previously demonstrated a

link between high levels of EFG and tumor development. Blocking the

protein's receptor has been shown to prevent tumor growth. This is

the first study to assess the relationship in humans, according to

the researchers.

When the EFG gene contains one or two guanine nucleotides (guanine

instead of the more common adenine), EFG is present in a greater

quantity in the blood, raising the carrier's risk of cancer, the

study found.

Knowing this, the research team analyzed tissue samples from 207

Massachusetts General Hospital patients with cirrhosis, the majority

of whom were infected with hepatitis C. Of that group, 59 had a

hepatocellular carcinoma. The researchers found that patients with at

least one copy of the guanine nucleotide were two times more likely

than patients with only adenine nucleotides to develop liver tumors.

Patients with two guanine nucleotides were four times more likely to

develop liver tumors.

The researchers also found that EFG levels were highest in those

people with two guanine nucleotides.

The team then analyzed data from patients at the Brousse

Hospital in Paris, most of whom suffered from alcoholic cirrhosis.

These patients were three times more likely to have a liver tumor if

they had two guanine nucleotides than if they had two adenine

nucleotides.

The researchers noted that age and gender had no effect on the

genetic risk of developing the tumor. The majority of the subjects

were Caucasian, but the researchers found an increased risk of the

genetic variation among Asian patients. More than half of

hepatocellular cancer cases worldwide occur in China.

Tanabe and his colleagues called for a study of patients with

cirrhosis before the development of liver cancer to better understand

other variables, such as diet and medications, that could affect EFG

levels.

Epidermal Growth Factor Gene Functional Polymorphism and the Risk of

Hepatocellular Carcinoma in Patients With Cirrhosis

JAMA. Jan 2 2008;299(1):53-60.

K. Tanabe, MD; Antoinette Lemoine, PharmD, PhD; Dianne M.

Finkelstein, PhD; Hiroshi Kawasaki, MD, PhD; Tsutomu Fujii, MD, PhD;

T. Chung, MD; Y. Lauwers, MD; Yakup Kulu, MD; Alona

Muzikansky, MA; Darshini Kuruppu, PhD; Lanuti, MD;

M. Goodwin, BS; Azoulay, MD, PhD; C. Fuchs, PhD

Author Affiliations: Division of Surgical Oncology (Drs Tanabe,

Kawasaki, Fujii, Kulu, Kuruppu, and Fuchs), Department of

Biostastistics (Dr Finklestein and Ms Muzikansky), Gastrointestinal

Unit, Department of Medicine (Dr Chung), Department of Pathology (Dr

Lauwers), and Division of Thoracic Surgery (Dr Lanuti and Mr

Goodwin), Massachusetts General Hospital, Harvard Medical School,

Boston; and Biochimie et Biologie Moléculaire (Dr Lemoine), Centre de

Chirurgie Hépatobiliaire (Dr Azoulay), Hôpital Brousse,

Assistance Publique-Hôpitaux de Paris; Université Paris-Sud/XI;

Faculté de Pharmacie, Châtenay-Malabry; Inserm, U602; Villejuif,

France. Drs Lemoine, Finkelstein, and Kawasaki contributed equally to

this study.

ABSTRACT

Context Overexpression of epidermal growth factor (EGF) in the liver

induces transformation to hepatocellular carcinoma in animal models.

Polymorphisms in the EGF gene modulate EGF levels.

Objective To assess the relationship among human EGF gene single-

nucleotide polymorphism, EGF expression, and risk of hepatocellular

carcinoma.

Design, Setting, and Participants Molecular mechanisms linking the

61*G allele polymorphism to EGF expression were examined in human

hepatocellular carcinoma cell lines and human liver tissue. A case-

control study involving 207 patients with cirrhosis was conducted at

the Massachusetts General Hospital (1999-2006) and a validation case-

control study involving 121 patients with cirrhosis was conducted at

Hôpital Brousse (1993-2006). Restriction fragment-length

polymorphism was used to determine the EGF gene polymorphism

genotype. Logistic regression analysis was used to assess the

association between the EGF polymorphism and hepatocellular carcinoma

risk.

Main Outcome Measures Mechanisms by which the EGF gene polymorphism

modulates EGF levels and associations among EGF gene polymorphism,

EGF levels, and hepatocellular carcinoma.

Results Transcripts from the EGF 61*G allele exhibited more than a 2-

fold longer half-life than those from the 61*A allele, and EGF

secretion was 2.3-fold higher in G/G hepatocellular carcinoma cell

lines than A/A cell lines. Serum EGF levels were 1.8-fold higher in

G/G patients than A/A patients, and liver EGF levels were 2.4-fold

higher in G/G patients than A/A patients. Among the 207 patients with

cirrhosis in the Massachusetts study population, 59 also had

hepatocellular carcinoma. Analysis of the distribution of allelic

frequencies revealed that there was a 4-fold odds of hepatocellular

carcinoma in G/G patients compared with A/A patients in the

Massachusetts study population (odds ratio, 4.0; 95% confidence

interval [CI], 1.6-9.6; P = .002). Logistic regression analysis

demonstrated that the number of copies of G was significantly

associated with hepatocellular carcinoma after adjusting for age,

sex, race, etiology, and severity of cirrhosis (G/G or A/G vs A/A;

hazard ratio, 3.49; 95% CI, 1.29-9.44; P = .01). The significant

association was validated in the French patients with alcoholic

cirrhosis and hepatocellular carcinoma.

Conclusion The EGF gene polymorphism genotype is associated with

risk for development of hepatocellular carcinoma in liver cirrhosis

through modulation of EGF levels.

COMMENT

Much effort has been directed toward understanding the role of EGF

receptors and their signaling pathways in transformation,25 tumor

progression,26 and drug response.27 The present study highlights the

important role of a growth factor itself on the initiation of a

primary tumor during the responses of the liver to chronic injury.

These data extend previous findings in animal models and provide

evidence of the importance of EGF in hepatocellular transformation in

humans. Results of this study strongly suggest that EGF gene single-

nucleotide polymorphism analysis and serum EGF measurements may serve

as novel markers for risk of hepatocellular carcinoma in patients

with cirrhosis. Epidermal growth factor up-regulation is a

characteristic of cirrhotic liver disease.28 Notably, human

hepatocyte transformation to anchorage-independent growth is enhanced

by EGF in a dose-dependent fashion (B.C.F. and K.K.T., unpublished

data, 2007). Differences in stability of mRNA transcribed from the 2

alleles are important because they lead to increased EGF mRNA

expression in G/G cell lines. Observations in cell lines often do not

fully recapitulate in vivo processes; however, these mRNA stability

experiments are of significance because of the observation that serum

and liver EGF levels are greater in G/G vs A/A patients. It is also

possible that other factors influence EGF levels (eg, age, ethnicity,

diet, medications), and thereby modulate risk for hepatocellular

carcinoma. The lack of an association between this EGF gene

polymorphism and plasma EGF levels has been reported in a group of

patients without cirrhosis.29 However, the major source of EGF in

blood is platelets,23 and therefore we performed EGF measurements in

serum and in liver tissue, which are presumed to be most relevant to

hepatocyte transformation in cirrhosis.

Whether higher EGF levels are associated with a greater risk for

developing cirrhosis is not addressed by this study. However, we

speculate that higher EGF does not raise the likelihood for

development of cirrhosis because the EGF gene single-nucleotide

polymorphism allelic distribution in our cirrhosis control group is

similar to what was reported about North American normal controls.30-

31 And, whether higher EGF levels are associated with a shorter time

to development of cirrhosis is not addressed by this study. In

theory, it is conceivable that higher EGF levels speed the onset of

cirrhosis in alcoholics or hepatis virus-infected individuals, and

thereby increase the odds of hepatocellular carcinoma in G/G patients

compared with A/A patients. However, our observation that the

severity of cirrhosis did not differ among our A/A, A/G, and G/G

patients argues against this possibility.

Recognizing the extremely high frequency of polymorphic changes in

the human genome, Rosenthal and Schwartz32 propose several criteria

to establish medically useful links between polymorphisms and

disease. First, it is essential to show that the change in the gene

causes a relevant alteration in the function or level of the gene

product. We have demonstrated modulation of EGF levels by the EGF

gene polymorphism; moreover, we have demonstrated a mechanism by

which EGF levels are modulated.

Second, the number of cases associating an allele with a particular

phenotype must be large enough to be convincing. The current study

involves 55 individuals with the G/G single-nucleotide polymorphism

in the Massachusetts study group, of which 23 (42%) had

hepatocellular carcinoma. Using an independent group of cirrhotic

patients, we validated the association between EGF gene single-

nucleotide polymorphism and hepatocellular carcinoma.

Third, the beneficial and harmful phenotypes being studied must have

clear-cut clinical differences. In the current study, there is little

equivocating between the presence and absence of hepatocellular

carcinoma in these well-studied populations, in which explanted

livers were carefully evaluated for the presence of hepatocellular

carcinoma.

Fourth, the plausibility of the hypothesis must be convincing.

Studies demonstrating enhanced in vitro transformation in the

presence of EGF, combined with animal models in which liver-directed

EGF overexpression causes hepatocellular carcinoma provide extremely

strong support for the linkage between EGF gene polymorphism and

hepatocellular carcinoma.16-17 In addition, it has been proposed that

the correlation between a particular single-nucleotide polymorphism

and a disease should have practical value. Our observations have

significant and immediate practical value in their relevance to

tailoring of screening strategies for different cirrhotic populations

based on their likelihood of developing hepatocellular carcinoma,

identification of other modulators of EGF levels, and development of

chemoprevention strategies that target EGF or EGF receptor. If a

compound were identified that effectively and safely lowers EGF

levels and risk for hepatocellular carcinoma, its use for

chemoprevention would likely be cost-effective compared with

strategies aimed at early detection and treatment of hepatocellular

carcinoma.

Schiffer et al33 demonstrated in a rat model in which

diethylnitrosamine induces cirrhosis within 12 weeks and subsequent

hepatocellular carcinoma at 18 weeks that concurrent treatment with

the selective EGF receptor tyrosine kinase inhibitor gefitinib during

weeks 12 through 18 significantly reduced the formation of

hepatocellular carcinoma nodules. When combined with these

preclinical study results, our findings in humans provide rationale

for examination of EGF-EGF receptor pathway as a novel target for

chemoprevention in humans. Unlike the situation related to the

previously published report linking the EGF gene single-nucleotide

polymorphism and melanoma,18 the presence of cirrhosis appears to be

an important prerequisite. Thus, one could consider a chemoprevention

strategy using agents that block the EGF-EGF receptor pathway in a

defined population.

The 2 populations involved in this study differ primarily in the

etiology of cirrhosis-predominantly hepatitis C virus in the

Massachusetts patients and solely alcohol in the French patients. The

effect of the number of copies of G differs in the 2 patient

populations. In the Massachusetts patients, each added G copy

increased the odds of hepatocellular carcinoma, whereas in the French

population, two G copies were required to increase the odds of

hepatocellular carcinoma. Additional studies are required to further

clarify the relationship between different etiologies of cirrhosis

and likelihood of transformation associated with EGF gene single-

nucleotide polymorphism. Because of the current study's retrospective

design and inability to control for severity of underlying liver

disease by liver histopathology (eg, Ishak score), prospective

studies examining larger populations of patients with

clinicopathological correlation will be of benefit. In addition, a

large majority of patients in the Massachusetts group and all of the

patients in the French group were white, and thus the application of

these observations to ethnic minorities awaits further study.

INTRODUCTION

Hepatocellular carcinoma is the sixth most common solid tumor

worldwide, with more than half occurring in China.1 It arises most

commonly in the setting of hepatic cirrhosis2 and chronic infection

with hepatitis B virus (HBV) and hepatitis C virus (HCV) are the most

important causes of cirrhosis and hepatocellular carcinoma.3 Only a

minority of patients with hepatocellular carcinoma are candidates for

potentially curative treatments of resection, transplantation, or

ablation, and because of its poor prognosis, hepatocellular carcinoma

is the third leading cause of cancer-related death.4 Because current

therapies are ineffective for most patients, prevention of HBV and

HCV transmission, identification of high-risk populations suitable

for screening and chemoprevention have been proposed as alternative

strategies.5

Screening strategies for high-risk populations include alpha

fetoprotein measurements and liver imaging. These techniques are

costly and are hindered by suboptimal sensitivity and specificity. To

this end, identification of molecular markers associated with an

increased risk of hepatocellular carcinoma would better define

populations at highest risk for hepatocellular carcinoma and may

additionally define important therapeutic targets for prevention and

treatment.

Epidermal growth factor, first isolated in 1962,6 has many biological

functions. It stimulates proliferation and differentiation of

epidermal and epithelial tissues.7-8 Epidermal growth factor is a

mitogen for adult and fetal hepatocytes grown in culture,9-10 and its

expression is up-regulated during liver regeneration.11 Mounting

evidence supports a role for EGF in malignant transformation and

tumor progression.12 Epidermal growth factor induces transformation

to anchorage-independent growth13 and enhances in vitro growth of

human epithelial- and mesenchymal-derived tumors.14 Overexpression of

a secreted human EGF fusion protein in fibroblasts enhances their

transformation to fibrosarcomas.15 Transgenic mice with liver-

targeted overexpression of the secreted EGF fusion protein develop

hepatocellular carcinoma.16 Gene expression profiles comparing normal

liver tissue with liver tumors in these mice suggest a role for an

autocrine mechanism during EGF-induced hepatocarcinogenesis.17

Shahbazi et al18 identified a single-nucleotide polymorphism

involving A to G transition at position 61 in the 5' untranslated

region of the EGF gene (SNP rs4444903). These investigators

demonstrated that in vitro cultures of peripheral blood mononuclear

cells from individuals with the G/G genotype secrete more EGF than

peripheral blood mononuclear cells from individuals with the A/A

genotype and that the G/G genotype was associated with an increased

risk of developing malignant melanoma compared with the A/A genotype.

In this study, we sought to perform a functional analysis of this EGF

gene single-nucleotide polymorphism, determine its influence on serum

and liver EGF levels, and assess its correlation with risk of

hepatocellular carcinoma in patients with cirrhosis.

Results

EGF Expression in Cell Lines

To analyze potential mechanisms by which the EGF gene polymorphism

modulates EGF expression, a restriction fragment-length polymorphism

strategy was used to genotype 12 human hepatoma cell lines for the

presence of the A to G single-nucleotide polymorphism at position 61

of the EGF gene (Figure 1). Three of the cell lines proved to be the

A/A genotype, 7 were G/G, and 2 were A/G. Because allelic variation

in gene expression can result from differences in mRNA stability,22

real-time PCR with allele-specific primers was used to determine the

stability of the different alleles after treatment with 5 µg/mL of

actinomycin D. The PLC/PRF/5 and HepG2 cell lines were used for this

experiment because they are heterozygous at the EGF gene

polymorphism, which allows for stability of both types of EGF mRNA

transcripts to be assessed in an otherwise identical environment.

The mRNA half-life for transcripts from the G allele was

significantly longer than the half-life of A allele transcripts in

both cell lines (P<.01; Figure 2). Greater stability of G allele

compared with A allele transcripts was also observed in primary

cultures of hepatocytes from patients heterozygous at the EGF gene

polymorphism (P<.01; Figure 2). As summarized in Table 1, in accord

with the greater stability of G allele mRNA, there was a

nonsignificant an increase in EGF mRNA with the number of copies of G

alleles in the 12 human hepatocellular carcinoma cell lines (P

= .06). More importantly, levels of intracellular EGF protein were

significantly greater in cell lines with more copies of G in the

genotype (P = .005), and cell lines secreted significantly more EGF

into media with the more copies of G in the genotype (P = .002).

EGF Polymorphisms in Cirrhotic Patients With Hepatocellular Carcinoma

Because EGF overexpression in the liver leads to development of

hepatocellular carcinoma in mouse models,16-17 we examined whether

the EGF gene polymorphism genotype correlated with risk for

hepatocellular carcinoma in patients with cirrhosis by examining the

EGF gene single-nucleotide polymorphism allelic distribution of all

patients identified as having cirrhosis in the Massachusetts General

Hospital Cancer Center Tumor bank.

Of these 207 patients, 59 also had hepatocellular carcinoma (Table

2). Clinically relevant factors of age, severity of cirrhosis,

etiology of cirrhosis, sex, and ethnicity were evaluated. (Duration

of cirrhosis cannot be determined with accuracy.) Sex and ethnic

distribution were similar in A/A, A/G, and G/G patients, with the

exception of Asians having more G copies than whites. The median age

and etiology of cirrhosis were also similar among the 3 groups. The

severity of cirrhosis as assessed by laboratory values used in the

Child classification-total bilirubin, albumin, prothrombin time-were

similar among the groups with the exception of slightly lower albumin

levels in G/G patients relative to A/A patients.

Patients with an A/G genotype had a 2.4-fold and patients with a G/G

genotype had 4.0-fold odds of developing hepatocellular carcinoma

compared with patients with the A/A genotype (Table 3). The number of

copies of G was significantly associated with hepatocellular

carcinoma (P = .001), further confirming this result. Logistic

regression analysis demonstrates that number of copies of G was

significantly associated with hepatocellular carcinoma, after

adjusting for age, sex, race, etiology, and severity of cirrhosis

(G/G plus A/G patients vs A/A patients hazard ratio, 3.49; 95%

confidence interval [CI], 1.29-9.44; P = .01).

Epidermal growth factor and phosphorylated EGF receptor levels were

measured in liver tissue specimens from 12 randomly selected patients

of each genotype with cirrhosis (36 patients total). Epidermal growth

factor levels were significantly higher in G/G patients than A/A

patients (P = .004; Table 4). Consistent with the finding of elevated

EGF levels was the finding of highest levels of phosphorylated EGF

receptor in livers from G/G patients compared with A/A patients (P

= .04). Serum was also isolated from 12 patients of each genotype

with cirrhosis for measurement of EGF levels. We measured EGF in

serum rather than in plasma because the major source of EGF in the

blood is platelets.23 Consistent with the results from biopsied liver

tissue, the level of EGF in the serum from G/G patients was

significantly higher than what was observed in A/A patients (P

= .0003). Epidermal growth factor levels were not merely a result of

greater cholestasis; neither serum (P = .47) nor liver (P = .62) EGF

levels correlated with total bilirubin.

We sought to confirm the relationship between EGF gene polymorphism

genotype and hepatocellular carcinoma in a separate study group of

patients with cirrhosis. Investigators at Hôpital Brousse have

published studies investigating the risk of hepatocellular carcinoma

in alcoholic patients with cirrhosis based on polymorphisms of the

methylenetetrahydrofolate reductase gene.24 For purposes of an EGF

gene polymorphism validation study, these investigators provided a

French study group in which alcohol consumption was the only known

etiology of cirrhosis; all patients tested negative for hepatitis A,

B, and C.

The EGF gene single-nucleotide polymorphism allelic distribution was

examined in this group of 121 white patients with cirrhosis, of whom

44 had hepatocellular carcinoma arising in their cirrhotic livers.

Child class was similar in A/A, A/G, and G/G patients (Table 5).

Total bilirubin, albumin, and prothrombin-time values were similar

among the groups. Patients with a G/G genotype had 2.9-fold odds of

developing hepatocellular carcinoma compared with A/A patients (Table

6). Logistic regression analysis demonstrated that number of copies

of G was significantly associated with hepatocellular carcinoma after

adjusting for age, sex, and Child class (G/G patients vs A/G plus A/A

patients hazard ratio, 4.87; 95% CI, 1.26-18.77; P = .021).

Methods

Cell Culture

Hepatocellular carcinoma cell lines SNU-182, SNU-387, SNU-398, SNU-

423, SNU-449, and SNU-47519 were obtained from American Type Culture

Collection (ATCC, Rockville, land). The SK-Hep, PLC/PRF/5, HepG2,

and Hep3B cell lines were provided by Barrie Bode, PhD (Saint Louis

University, St Louis, Missouri). These 10 cell lines represent all

hepatocellular carcinoma cell lines that are currently commercially

available in the United States. Additionally, we obtained HuH-7 cells

from Jake Liang, MD (National Institute of Diabetes and Digestive and

Kidney Diseases, Bethesda, land) and Focus cells from Jack Wands,

MD, (Brown University, Providence, Rhode Island). All the cell lines

were propagated identically in Dulbecco Modified Eagle Medium (4.5

mg/mL glucose, 2 mM L-glutamine) with 10% fetal bovine serum (both

from MediaTech CellGro, Herndon, Virginia), supplemented with 100

U/mL penicillin and 100 mg/mL streptomycin (Invitrogen, Carlsbad,

California). Cells were maintained at 37°C in a humidified incubator

with 5% CO2 in air. Primary cultures of human hepatocytes were

prepared as previously described.20

Tissue and Clinical Information

Of 7140 patients with blood or tissue stored in the Massachusetts

General Hospital Cancer Center Tumor Bank between the years 1999 and

2006, 207 were identified as having cirrhosis and were included in

this study. Fifty-nine of these patients had hepatocellular carcinoma

and were designated as cases, and the remaining 148 patients served

as controls. Clinical information and tissues were obtained under

protocols approved by the Dana-Farber Harvard Cancer Center Office

for Protection of Human Subjects and the Partners Human Research

Committee.

For validation of EGF gene single-nucleotide polymorphism genotype

results observed in the Massachusetts population, an independent

group of 121 French patients with alcoholic cirrhosis seen at Hôpital

Brousse between the years 1993 and 2006 was genotyped using

blood or liver tissue as approved by Hôpital Brousse Centre de

Ressources Biologiques. Forty-four of these patients had

hepatocellular carcinoma (cases), and the remaining 77 patients

served as controls. Neither serum nor tissue was available for

analysis from this group. Ethnicity was studied because single-

nucleotide polymorphism frequencies are known to differ between

ethnic groups. Ethnicity was self-classified by each subject.

DNA Extraction and Genotyping of EGF Gene

DNA was extracted from hepatocellular carcinoma cell lines (1 x 106

cells) and formalin fixed paraffin-embedded tissue (three 10-µm

sections per each patient case) using the MasterPure Purification

(Epicenter, Madison, Wisconsin). Lymphocytes were isolated from whole

blood using Histopaque1077 (Sigma, St Louis), followed by DNA

isolation as described above. The EGF polymorphism was analyzed in

duplicate, independently by 2 different investigators using

restriction fragment-length polymorphism as described previously.18

Briefly, genomic DNA was subjected to polymerase chain reaction (PCR)

amplification (initial denaturation at 95°C for 5 minutes, followed

by 35 cycles at 95°C for 30 seconds, 51°C for 30 seconds, and 72°C

for 1 minute with a final extension step of 7 minutes at 72°C) to

amplify nucleotide positions -78 to +164 of the EGF gene. The

following primers were used: forward-TGTCACTAAAGGAAAGGAGGT and

reverse-TTCACAGAGTTTAACAGCCC. The 25 µL PCR product was digested

overnight with 5 units of AluI at 37°C, separated by electrophoresis

in a 3% agarose gel and visualized by staining with ethidium bromide.

AluI digestion of the 242 base pair (bp) PCR product containing the

61*G allele produced 15, 34, and 193 bp fragments, while digestion of

the 61*A allele produced 15, 34, 91, and 102 bp fragments.

Real-Time PCR

Epidermal growth factor messenger RNA (mRNA) in hepatocellular

carcinoma cell lines was measured by quantitative reverse

transcription-PCR (LightCycler; Roche Diagnostics Corp, Indianapolis,

Indiana). Cells were plated at 1 x 105 cells/mL in 10 mL of media in

10-cm plates and allowed to grow for 48 hours to reach log phase

growth. Total RNA was extracted from each cell line using TRIzol

(Invitrogen) and subsequently treated with DNase I (Promega,

Madison). Two hundred fifty nanograms of total RNA from each sample

was used to synthesize complementary DNA (cDNA) by single-strand

reverse transcription (SuperScript III First-Strand Synthesis

SuperMix for qRT-PCR; Invitrogen). All of the sample cDNAs were

pooled together to create a quantitative standard control. The level

of EGF mRNA present is expressed as the ratio of EGF PCR product to

beta2-microglobulin PCR product. All reactions were performed in

duplicate and experiments were repeated to ensure accuracy. The

following primer sequences were used for PCR amplification of cDNA,

EGF forward: CTTGTCATGCTGCTCCTCCT, reverse: GAGGGCATATGAAAGCTTCG and

beta2-microglobulin forward: TTTCATCCATCCGACATTGA, reverse:

ATCTTCAAACCTCCATGATG.

For mRNA stability studies, PLC/PRF/5 and HepG2 cells were plated at

1 x 105 cells/mL in 10 mL of media in 10-cm plates. After 48 hours,

cells were washed once with phosphate-buffered saline and fresh media

was added containing 5 µg/mL actinomycin D (Sigma). At the indicated

times, RNA was isolated and cDNA was synthesized as described above.

A quantitative standard control was created from the time zero cDNA

(control) and the level of EGF mRNA present at each time point is

expressed as the percentage of control. The half-life of each EGF

mRNA allele (A or G) was calculated based on the time point at which

mRNA levels had declined to 50% of their original levels. All of the

reactions were performed in duplicate and the experiment was repeated

to ensure accuracy. The following allele-specific primers were used:

EGF 61*A forward: GCCCCAATCCAAGGGTTGTA; EGF 61*G forward:

GCCCCAATCCAAGGGTTGTG; and reverse primer for both alleles:

GCCAAGGGAAGCCACAGGAAAG. Similar studies were performed on primary

cultures of human hepatocytes established from resected liver

specimens from EGF 61A/G (heterozygous) patients. Hepatocyte cultures

were established as previously described.21

EGF and Phospho-EGF Receptor Enzyme-Linked Immunosorbent Assay

The phosphorylated EGF receptor was quantified using an enzyme-linked

immunosorbent assay (R & D Systems, Minneapolis, Minnesota). Epidermal

growth factor protein was quantified using an enzyme-linked

immunosorbent assay (PeproTech, Rocky Hill, New Jersey). Experiments

were performed in triplicate and were repeated to ensure accuracy.

Cells were plated at 1 x 105 cells/mL in 10-mL of media in 10-cm

plates. After 48 hours, cells were washed in ice-cold phosphate-

buffered saline and harvested in 500 µL of radioimmunoprecipitation

assay buffer (Boston BioProducts, Worcester, Massachusetts)

containing protease inhibitors (Sigma). For tissue lysates, 0.01 g of

tissue (confirmed to be cirrhotic liver) was cut into small pieces,

resuspended on ice in 400 µL of radioimmunoprecipitation assay buffer

containing protease inhibitors and homogenized with a sonicator.

Lysates were incubated on ice for 10 minutes with occasional

vortexing and then centrifuged at 12 000 rpm for 30 minutes at 4°C.

The supernatant was removed and protein concentration was analyzed by

the bicinchoninic acid method (Pierce Chemical Co, Rockford,

Illinois). Each enzyme-linked immunosorbent assay plate well was

incubated overnight with 100 µL of capture antibody (1 µg/mL) before

blocking with 1% bovine serum albumin in phosphate buffered saline

(PBS) for 1 hour. Cell or tissue lysates (100 µg per well) were

incubated for 2 hours, followed by addition of 100 µL of detection

antibody (0.25 µg/mL) for 2 hours before incubation with 100 µL of

avidin peroxidase (1:2000) for 30-minutes. Wells were washed 4 times

with phosphate-buffered saline containing 0.05% Tween-20 (Sigma)

between each step. Color development was monitored at 405 nm after

the addition of 100 µL of 2,2'-azino-bis(3-ethylbenzothiazoline-6-

sulfonic acid) (ABTS; Sigma) using a spectrophotometric plate reader

(Emax; Molecular Devices).

To measure EGF in conditioned media, 1 x 105 cells in 2 mL of media

were grown in a 6 cm plate for 24 hours. Cells were then washed with

phosphate-buffered saline and 2 mL of fresh media was added. After 48

hours, the media was collected for analysis and the cells were

harvested in 0.2% sodium dodecyl sulfate plus 0.2N NaOH to determine

protein content by bicinchoninic acid. Conditioned media (100 µL per

well) was analyzed and results were normalized to the number of cells

present as determined by the bicinchoninic acid. For serum analysis,

10 mL of freshly obtained blood (red top tube) was allowed to clot

for 120 minutes at 4°C before centrifugation at 2000 rpm for 10

minutes at 4°C. Serum was isolated and stored at -80°C prior to use.

Statistical Methods

Comparisons of groups with regard to odds of hepatocellular carcinoma

were made using a logistic regression model; age, sex, ethnicity,

etiology of cirrhosis, and severity of cirrhosis were included as

covariates in addition to genotype. Comparisons of EGF expression in

cell lines and tissue/serum by number of copies of G were made using

a Jonckheere-Terpstra test; pair-wise comparisons were made using

exact Wilcoxon-Mann-Whitney test in StatXact (Cytel Inc, Cambridge,

Massachusetts). Comparisons of rates of hepatocellular carcinoma in

groups defined by genotype were made using Fisher Exact test.